EMAIL THIS PAGE TO A FRIEND

BIRC5

baculoviral IAP repeat containing 5

115 Gene Product Result for
Synonyms: API4 EPR-1
Gene ID:
Human(332) Summary: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(11799) baculoviral IAP repeat-containing 5
Rat(64041) baculoviral IAP repeat-containing 5
chicken(374078) baculoviral IAP repeat containing 5
dog(442936) baculoviral IAP repeat containing 5
cow(414925) baculoviral IAP repeat containing 5
Horse(100050808) baculoviral IAP repeat containing 5
domestic cat(493835) baculoviral IAP repeat containing 5
sheep(101123390) baculoviral IAP repeat containing 5
naked mole-rat(101703201) baculoviral IAP repeat containing 5
domestic guinea pig(100527953) baculoviral IAP repeat-containing 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405470 Anti-BIRC5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA002830 Anti-BIRC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
PRS2237 Anti-mSurvivin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301522 Anti-phospho-Survivin (pThr117) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503993 Anti-phospho-Survivin (pThr34) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
S8191 Anti-Survivin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
microarray, western blot pricing
SAB3500269 Anti-Survivin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501460 Anti-Survivin antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500179 Anti-Survivin antibody, Rabbit monoclonal clone SP79, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4501459 Anti-Survivin, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB2501004 Anti-SURVIVIN/BIRC5 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, bovine, human, canine, cat
ELISA, western blot pricing
WH0000332M1 Monoclonal Anti-BIRC5 antibody produced in mouse clone 5B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation, western blot pricing
SAB4100131 Monoclonal Anti-BIRC5 antibody produced in mouse clone BIRC5-A113, culture supernatant human
western blot pricing
SAB5300510 Monoclonal Anti-BIRC5 antibody produced in mouse clone 2H5H2, ascites fluid human
ELISA, western blot pricing
SAB5300511 Monoclonal Anti-BIRC5 antibody produced in mouse clone 1H5, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU170821 MISSION® esiRNA esiRNA targeting mouse Birc5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012270 siRNAs that have been validated in the lab human pricing
NM_001012271 siRNAs that have been validated in the lab human pricing
NM_001168 siRNAs that have been validated in the lab human pricing
NM_022274 Rosetta Predictions rat pricing
NM_001012273 Rosetta Predictions mouse pricing
NM_009689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012270 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139569 validated 794
2 SASI_Hs01_00139565 predicted 1001
3 SASI_Hs01_00139566 predicted 788
4 SASI_Hs02_00306059 predicted 997
5 SASI_Hs01_00139570 predicted 820
6 SASI_Hs02_00306060 predicted 481
7 SASI_Hs02_00306061 predicted 702
8 SASI_Hs02_00306062 predicted 704
9 SASI_Hs02_00306063 predicted 707
10 SASI_Hs02_00306064 predicted 754
11 SASI_Hs01_00139563 predicted 343
12 SASI_Hs01_00139564 predicted 278
13 SASI_Hs01_00139567 predicted 560
14 SASI_Hs01_00139568 predicted 172
15 SASI_Hs01_00139571 predicted 988
16 SASI_Hs01_00139572 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012271 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094389 validated 989
2 SASI_Hs01_00094390 predicted 1004
3 SASI_Hs01_00094391 predicted 424
4 SASI_Hs01_00094392 predicted 440
5 SASI_Hs01_00094394 predicted 434
6 SASI_Hs01_00094395 predicted 424
7 SASI_Hs01_00094397 predicted 522
8 SASI_Hs02_00306065 predicted 668
9 SASI_Hs02_00306066 predicted 900
10 SASI_Hs02_00306067 predicted 529
11 SASI_Hs01_00094388 predicted 277
12 SASI_Hs01_00094393 predicted 175
13 SASI_Hs01_00094396 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001168 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052229 validated 919
1 SASI_Hs01_00052232 validated 366
1 SASI_Hs01_00052230 validated 937
1 SASI_Hs01_00052228 validated 279
1 SASI_Hs01_00052236 validated 279
1 SASI_Hs01_00052233 validated 172
1 SASI_Hs01_00052231 validated 355
1 SASI_Hs01_00052237 validated 456
1 SASI_Hs01_00052235 validated 351
1 SASI_Hs01_00052234 validated 372
2 SASI_Hs02_00331288 predicted 599
3 SASI_Hs02_00331289 predicted 831
4 SASI_Hs02_00331290 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070093 predicted 286
2 SASI_Rn01_00070094 predicted 474
3 SASI_Rn01_00070095 predicted 413
4 SASI_Rn01_00070096 predicted 207
5 SASI_Rn02_00263081 predicted 362
6 SASI_Rn01_00070097 predicted 442
7 SASI_Rn02_00263082 predicted 195
8 SASI_Rn01_00070099 predicted 212
9 SASI_Rn01_00070100 predicted 541
10 SASI_Rn01_00070101 predicted 620
11 SASI_Rn01_00070098 predicted 340
12 SASI_Rn01_00070102 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287065 predicted 229
2 SASI_Mm02_00287066 predicted 447
3 SASI_Mm02_00287067 predicted 855
4 SASI_Mm02_00287068 predicted 606
5 SASI_Mm02_00287069 predicted 863
6 SASI_Mm02_00287070 predicted 860
7 SASI_Mm02_00287071 predicted 329
8 SASI_Mm02_00287072 predicted 455
9 SASI_Mm02_00287073 predicted 545
10 SASI_Mm02_00287074 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032714 predicted 693
2 SASI_Mm01_00032716 predicted 739
3 SASI_Mm01_00032718 predicted 725
4 SASI_Mm02_00316778 predicted 726
5 SASI_Mm02_00316779 predicted 655
6 SASI_Mm02_00316780 predicted 689
7 SASI_Mm02_00316781 predicted 721
8 SASI_Mm02_00316782 predicted 718
9 SASI_Mm01_00032720 predicted 742
10 SASI_Mm02_00316783 predicted 656
11 SASI_Mm01_00032713 predicted 504
12 SASI_Mm01_00032715 predicted 332
13 SASI_Mm01_00032717 predicted 266
14 SASI_Mm01_00032719 predicted 540
15 SASI_Mm01_00032721 predicted 254
16 SASI_Mm01_00032722 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009689
VALIDATED
BIRC5 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-491s1c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-324s1c1
Sequence:CCGGCCCGATAGAGGAGCATAGAAACTCGAGTTTCTATGCTCCTCTATCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-247s1c1
Sequence:CCGGCCTACCGAGAACGAGCCTGATCTCGAGATCAGGCTCGTTCTCGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-138s1c1
Sequence:CCGGGCAGCTGTACCTCAAGAACTACTCGAGTAGTTCTTGAGGTACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-388s1c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-497s21c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-394s21c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009689.2-256s21c1
Sequence:CCGGACCGAGAACGAGCCTGATTTGCTCGAGCAAATCAGGCTCGTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-727s21c1
Sequence:CCGGTCTATTGTGACGTGGACTTAACTCGAGTTAAGTCCACGTCACAATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009689
VALIDATED
BIRC5 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-491s1c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-324s1c1
Sequence:CCGGCCCGATAGAGGAGCATAGAAACTCGAGTTTCTATGCTCCTCTATCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-247s1c1
Sequence:CCGGCCTACCGAGAACGAGCCTGATCTCGAGATCAGGCTCGTTCTCGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-138s1c1
Sequence:CCGGGCAGCTGTACCTCAAGAACTACTCGAGTAGTTCTTGAGGTACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-388s1c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-497s21c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-394s21c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009689.2-256s21c1
Sequence:CCGGACCGAGAACGAGCCTGATTTGCTCGAGCAAATCAGGCTCGTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-727s21c1
Sequence:CCGGTCTATTGTGACGTGGACTTAACTCGAGTTAAGTCCACGTCACAATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009689
VALIDATED
BIRC5 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-491s1c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-324s1c1
Sequence:CCGGCCCGATAGAGGAGCATAGAAACTCGAGTTTCTATGCTCCTCTATCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009689.1-247s1c1
Sequence:CCGGCCTACCGAGAACGAGCCTGATCTCGAGATCAGGCTCGTTCTCGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-138s1c1
Sequence:CCGGGCAGCTGTACCTCAAGAACTACTCGAGTAGTTCTTGAGGTACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009689.1-388s1c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-497s21c1
Sequence:CCGGCAAAGACTACCCGTCAGTCAACTCGAGTTGACTGACGGGTAGTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-394s21c1
Sequence:CCGGGAAGAACTAACCGTCAGTGAACTCGAGTTCACTGACGGTTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009689.2-256s21c1
Sequence:CCGGACCGAGAACGAGCCTGATTTGCTCGAGCAAATCAGGCTCGTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009689.2-727s21c1
Sequence:CCGGTCTATTGTGACGTGGACTTAACTCGAGTTAAGTCCACGTCACAATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001168
VALIDATED
BIRC5 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-214s1c1
Sequence:CCGGCCAGTGTTTCTTCTGCTTCAACTCGAGTTGAAGCAGAAGAAACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-307s1c1
Sequence:CCGGCCTTTCTGTCAAGAAGCAGTTCTCGAGAACTGCTTCTTGACAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001168.1-329s1c1
Sequence:CCGGGAAGAATTAACCCTTGGTGAACTCGAGTTCACCAAGGGTTAATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001168.1-100s1c1
Sequence:CCGGCCGCATCTCTACATTCAAGAACTCGAGTTCTTGAATGTAGAGATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-587s21c1
Sequence:CCGGGCACCACTTCCAGGGTTTATTCTCGAGAATAAACCCTGGAAGTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-404s21c1
Sequence:CCGGGAATTAACCCTTGGTGAATTTCTCGAGAAATTCACCAAGGGTTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-291s1c2
Sequence:CCGGCGTCCGGTTGCGCTTTCCTTTCTCGAGAAAGGAAAGCGCAACCGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-651s21c1
Sequence:CCGGTAGGAAAGGAGATCAACATTTCTCGAGAAATGTTGATCTCCTTTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-433s21c1
Sequence:CCGGGGACAGAGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCTCTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-459s21c1
Sequence:CCGGTTGCAAAGGAAACCAACAATACTCGAGTATTGTTGGTTTCCTTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-159s21c1
Sequence:CCGGTTCTCAAGGACCACCGCATCTCTCGAGAGATGCGGTGGTCCTTGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001168
VALIDATED
BIRC5 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-214s1c1
Sequence:CCGGCCAGTGTTTCTTCTGCTTCAACTCGAGTTGAAGCAGAAGAAACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-307s1c1
Sequence:CCGGCCTTTCTGTCAAGAAGCAGTTCTCGAGAACTGCTTCTTGACAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001168.1-329s1c1
Sequence:CCGGGAAGAATTAACCCTTGGTGAACTCGAGTTCACCAAGGGTTAATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001168.1-100s1c1
Sequence:CCGGCCGCATCTCTACATTCAAGAACTCGAGTTCTTGAATGTAGAGATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-587s21c1
Sequence:CCGGGCACCACTTCCAGGGTTTATTCTCGAGAATAAACCCTGGAAGTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-404s21c1
Sequence:CCGGGAATTAACCCTTGGTGAATTTCTCGAGAAATTCACCAAGGGTTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-291s1c2
Sequence:CCGGCGTCCGGTTGCGCTTTCCTTTCTCGAGAAAGGAAAGCGCAACCGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-651s21c1
Sequence:CCGGTAGGAAAGGAGATCAACATTTCTCGAGAAATGTTGATCTCCTTTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-433s21c1
Sequence:CCGGGGACAGAGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCTCTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-459s21c1
Sequence:CCGGTTGCAAAGGAAACCAACAATACTCGAGTATTGTTGGTTTCCTTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-159s21c1
Sequence:CCGGTTCTCAAGGACCACCGCATCTCTCGAGAGATGCGGTGGTCCTTGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001168
VALIDATED
BIRC5 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-214s1c1
Sequence:CCGGCCAGTGTTTCTTCTGCTTCAACTCGAGTTGAAGCAGAAGAAACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-307s1c1
Sequence:CCGGCCTTTCTGTCAAGAAGCAGTTCTCGAGAACTGCTTCTTGACAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001168.1-329s1c1
Sequence:CCGGGAAGAATTAACCCTTGGTGAACTCGAGTTCACCAAGGGTTAATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001168.1-100s1c1
Sequence:CCGGCCGCATCTCTACATTCAAGAACTCGAGTTCTTGAATGTAGAGATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-587s21c1
Sequence:CCGGGCACCACTTCCAGGGTTTATTCTCGAGAATAAACCCTGGAAGTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-404s21c1
Sequence:CCGGGAATTAACCCTTGGTGAATTTCTCGAGAAATTCACCAAGGGTTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001168.1-291s1c2
Sequence:CCGGCGTCCGGTTGCGCTTTCCTTTCTCGAGAAAGGAAAGCGCAACCGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168.2-651s21c1
Sequence:CCGGTAGGAAAGGAGATCAACATTTCTCGAGAAATGTTGATCTCCTTTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-433s21c1
Sequence:CCGGGGACAGAGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCTCTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-459s21c1
Sequence:CCGGTTGCAAAGGAAACCAACAATACTCGAGTATTGTTGGTTTCCTTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168.2-159s21c1
Sequence:CCGGTTCTCAAGGACCACCGCATCTCTCGAGAGATGCGGTGGTCCTTGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)