EMAIL THIS PAGE TO A FRIEND

BIRC6

baculoviral IAP repeat containing 6

156 Gene Product Result for
Synonyms: APOLLON BRUCE
UniProtKB ID: Q9NR09, Q9ULD1
Gene ID:
Human(57448) Summary: This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
Mouse(12211) baculoviral IAP repeat-containing 6
Rat(313876) baculoviral IAP repeat-containing 6
naked mole-rat(101704045) baculoviral IAP repeat containing 6
domestic guinea pig(100735665) baculoviral IAP repeat containing 6
sheep(101103635) baculoviral IAP repeat containing 6
Domestic Rabbit(100342432) baculoviral IAP repeat containing 6
Zebrafish(796547) baculoviral IAP repeat-containing 6
cow(534211) baculoviral IAP repeat containing 6
Horse(100070568) baculoviral IAP repeat containing 6
domestic cat(101087396) baculoviral IAP repeat containing 6
dog(475718) baculoviral IAP repeat containing 6
chicken(421463) baculoviral IAP repeat containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007566 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007566 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007566 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016252 Rosetta Predictions human pricing
XM_001065439 Rosetta Predictions rat pricing
XM_233842 Rosetta Predictions rat pricing
NM_007566 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172666 predicted 10644
2 SASI_Hs02_00349133 predicted 11366
3 SASI_Hs02_00349134 predicted 9630
4 SASI_Hs01_00172670 predicted 548
5 SASI_Hs01_00172671 predicted 12777
6 SASI_Hs02_00349135 predicted 2486
7 SASI_Hs01_00172672 predicted 14641
8 SASI_Hs01_00172673 predicted 5517
9 SASI_Hs02_00349136 predicted 4561
10 SASI_Hs01_00172674 predicted 4326
11 SASI_Hs01_00172667 predicted 1142
12 SASI_Hs01_00172668 predicted 1747
13 SASI_Hs01_00172669 predicted 6278
14 SASI_Hs01_00172675 predicted 6805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065439 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314117 predicted 8047
2 SASI_Rn02_00314118 predicted 7911
3 SASI_Rn02_00314119 predicted 2781
4 SASI_Rn02_00314120 predicted 9966
5 SASI_Rn02_00314121 predicted 1092
6 SASI_Rn02_00314122 predicted 13645
7 SASI_Rn02_00314123 predicted 2802
8 SASI_Rn02_00314124 predicted 6507
9 SASI_Rn02_00314125 predicted 2768
10 SASI_Rn02_00314126 predicted 9816
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388090 predicted 8034
2 SASI_Rn02_00388091 predicted 7897
3 SASI_Rn02_00388092 predicted 2785
4 SASI_Rn02_00388093 predicted 9955
5 SASI_Rn02_00388094 predicted 12007
6 SASI_Rn02_00388095 predicted 1083
7 SASI_Rn02_00388096 predicted 13634
8 SASI_Rn02_00388097 predicted 2806
9 SASI_Rn02_00388098 predicted 6500
10 SASI_Rn02_00388099 predicted 2776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007566 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311934 predicted 9449
2 SASI_Mm01_00095102 predicted 2508
3 SASI_Mm02_00311935 predicted 818
4 SASI_Mm01_00095103 predicted 2538
5 SASI_Mm02_00311936 predicted 12056
6 SASI_Mm01_00095104 predicted 2498
7 SASI_Mm02_00311937 predicted 11787
8 SASI_Mm02_00311938 predicted 6706
9 SASI_Mm01_00095106 predicted 7784
10 SASI_Mm02_00311939 predicted 13456
11 SASI_Mm01_00095100 predicted 6748
12 SASI_Mm01_00095101 predicted 5768
13 SASI_Mm01_00095105 predicted 8723
14 SASI_Mm01_00095107 predicted 6606
15 SASI_Mm01_00095108 predicted 597
16 SASI_Mm01_00095109 predicted 14725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016252
VALIDATED
BIRC6 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-10116s21c1
Sequence:CCGGATTGGATGGTTACGGTTATTACTCGAGTAATAACCGTAACCATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5451s21c1
Sequence:CCGGCCGCCTCACCAGTCCATTATTCTCGAGAATAATGGACTGGTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-13131s21c1
Sequence:CCGGCCCGTCAGTAGTGCGGTAAATCTCGAGATTTACCGCACTACTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016252.3-14962s21c1
Sequence:CCGGTGGATAAATCACTGCTATATACTCGAGTATATAGCAGTGATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5626s21c1
Sequence:CCGGTGGTAGTGGCAACTGATATAACTCGAGTTATATCAGTTGCCACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-5718s21c1
Sequence:CCGGGGACGTTACGGGAGTACAAATCTCGAGATTTGTACTCCCGTAACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-12179s1c1
Sequence:CCGGCCATGCTATATCCAGAAGTAACTCGAGTTACTTCTGGATATAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-13448s1c1
Sequence:CCGGCGGCTATGAAACCCAAACCTTCTCGAGAAGGTTTGGGTTTCATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-8161s1c1
Sequence:CCGGGCTCATTTGTTGGTTTCAGATCTCGAGATCTGAAACCAACAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-2281s1c1
Sequence:CCGGGCTGTAGTGAATGGTGCAAATCTCGAGATTTGCACCATTCACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-11209s1c1
Sequence:CCGGGCGTTCTTTCTACAGTGCATTCTCGAGAATGCACTGTAGAAAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016252
VALIDATED
BIRC6 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-10116s21c1
Sequence:CCGGATTGGATGGTTACGGTTATTACTCGAGTAATAACCGTAACCATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5451s21c1
Sequence:CCGGCCGCCTCACCAGTCCATTATTCTCGAGAATAATGGACTGGTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-13131s21c1
Sequence:CCGGCCCGTCAGTAGTGCGGTAAATCTCGAGATTTACCGCACTACTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016252.3-14962s21c1
Sequence:CCGGTGGATAAATCACTGCTATATACTCGAGTATATAGCAGTGATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5626s21c1
Sequence:CCGGTGGTAGTGGCAACTGATATAACTCGAGTTATATCAGTTGCCACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-5718s21c1
Sequence:CCGGGGACGTTACGGGAGTACAAATCTCGAGATTTGTACTCCCGTAACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-12179s1c1
Sequence:CCGGCCATGCTATATCCAGAAGTAACTCGAGTTACTTCTGGATATAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-13448s1c1
Sequence:CCGGCGGCTATGAAACCCAAACCTTCTCGAGAAGGTTTGGGTTTCATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-8161s1c1
Sequence:CCGGGCTCATTTGTTGGTTTCAGATCTCGAGATCTGAAACCAACAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-2281s1c1
Sequence:CCGGGCTGTAGTGAATGGTGCAAATCTCGAGATTTGCACCATTCACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-11209s1c1
Sequence:CCGGGCGTTCTTTCTACAGTGCATTCTCGAGAATGCACTGTAGAAAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016252
VALIDATED
BIRC6 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-10116s21c1
Sequence:CCGGATTGGATGGTTACGGTTATTACTCGAGTAATAACCGTAACCATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5451s21c1
Sequence:CCGGCCGCCTCACCAGTCCATTATTCTCGAGAATAATGGACTGGTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-13131s21c1
Sequence:CCGGCCCGTCAGTAGTGCGGTAAATCTCGAGATTTACCGCACTACTGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016252.3-14962s21c1
Sequence:CCGGTGGATAAATCACTGCTATATACTCGAGTATATAGCAGTGATTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016252.3-5626s21c1
Sequence:CCGGTGGTAGTGGCAACTGATATAACTCGAGTTATATCAGTTGCCACTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016252.3-5718s21c1
Sequence:CCGGGGACGTTACGGGAGTACAAATCTCGAGATTTGTACTCCCGTAACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-12179s1c1
Sequence:CCGGCCATGCTATATCCAGAAGTAACTCGAGTTACTTCTGGATATAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-13448s1c1
Sequence:CCGGCGGCTATGAAACCCAAACCTTCTCGAGAAGGTTTGGGTTTCATAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-8161s1c1
Sequence:CCGGGCTCATTTGTTGGTTTCAGATCTCGAGATCTGAAACCAACAAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016252.x-2281s1c1
Sequence:CCGGGCTGTAGTGAATGGTGCAAATCTCGAGATTTGCACCATTCACTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016252.x-11209s1c1
Sequence:CCGGGCGTTCTTTCTACAGTGCATTCTCGAGAATGCACTGTAGAAAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007566
VALIDATED
BIRC6 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-2639s21c1
Sequence:CCGGTGTCGTCAGTGGTGGATATTTCTCGAGAAATATCCACCACTGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007566.2-15269s21c1
Sequence:CCGGCATATCTTCATGCTCATATTTCTCGAGAAATATGAGCATGAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-9203s21c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-2505s21c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-10522s21c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-6552s1c1
Sequence:CCGGCCCACAAGATAGGGTCTTTATCTCGAGATAAAGACCCTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-2506s1c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-9177s1c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-14080s1c1
Sequence:CCGGCCCTATGCAAATGGCTGCTTTCTCGAGAAAGCAGCCATTTGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-10496s1c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007566
VALIDATED
BIRC6 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-2639s21c1
Sequence:CCGGTGTCGTCAGTGGTGGATATTTCTCGAGAAATATCCACCACTGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007566.2-15269s21c1
Sequence:CCGGCATATCTTCATGCTCATATTTCTCGAGAAATATGAGCATGAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-9203s21c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-2505s21c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-10522s21c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-6552s1c1
Sequence:CCGGCCCACAAGATAGGGTCTTTATCTCGAGATAAAGACCCTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-2506s1c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-9177s1c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-14080s1c1
Sequence:CCGGCCCTATGCAAATGGCTGCTTTCTCGAGAAAGCAGCCATTTGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-10496s1c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007566
VALIDATED
BIRC6 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-2639s21c1
Sequence:CCGGTGTCGTCAGTGGTGGATATTTCTCGAGAAATATCCACCACTGACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007566.2-15269s21c1
Sequence:CCGGCATATCTTCATGCTCATATTTCTCGAGAAATATGAGCATGAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-9203s21c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007566.2-2505s21c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007566.2-10522s21c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-6552s1c1
Sequence:CCGGCCCACAAGATAGGGTCTTTATCTCGAGATAAAGACCCTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-2506s1c1
Sequence:CCGGGCACTATGTAATAGACGTAAACTCGAGTTTACGTCTATTACATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-9177s1c1
Sequence:CCGGCCAGCAAATTATGAGCCAGATCTCGAGATCTGGCTCATAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-14080s1c1
Sequence:CCGGCCCTATGCAAATGGCTGCTTTCTCGAGAAAGCAGCCATTTGCATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007566.1-10496s1c1
Sequence:CCGGCCTCTGATTCTACAATAGATACTCGAGTATCTATTGTAGAATCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks