EMAIL THIS PAGE TO A FRIEND

BIRC7

baculoviral IAP repeat containing 7

91 Gene Product Result for
Synonyms: KIAP LIVIN ML-IAP MLIAP RNF50
UniProtKB ID: Q96CA5, Q9BQV0, Q9H2A8, Q9HAP7
Gene ID:
Human(79444) Summary: The protein encoded by this gene is a member of the family of inhibitor of apoptosis proteins (IAP) and contains a single copy of a baculovirus IAP repeat (BIR) as well as a RING-type zinc finger domain. The BIR domain is essential for inhibitory activity and interacts with caspases, while the RING finger domain sometimes enhances antiapoptotic activity but does not inhibit apoptosis alone. Two transcript variants encoding different isoforms have been found for this gene. The two isoforms have different antiapoptotic properties, with isoform alpha protecting cells from apoptosis induced by staurosporine and isoform b protecting cells from apoptosis induced by etoposide. [provided by RefSeq, Jul 2008]
Mouse(329581) baculoviral IAP repeat-containing 7 (livin)
Rat(296468) baculoviral IAP repeat-containing 7
Zebrafish(100073331) baculoviral IAP repeat-containing 7
cow(514508) baculoviral IAP repeat containing 7
domestic cat(101080371) baculoviral IAP repeat containing 7
dog(485969) baculoviral IAP repeat containing 7
chicken(419239) baculoviral IAP repeat containing 7
sheep(101110435) baculoviral IAP repeat containing 7
domestic guinea pig(100717708) baculoviral IAP repeat containing 7
naked mole-rat(101709798) baculoviral IAP repeat containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300740 Anti-BIRC7 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1407949 Anti-BIRC7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103895 Anti-BIRC7 antibody produced in rabbit affinity isolated antibody rabbit, human
western blot pricing
HPA047850 Anti-BIRC7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2900354 Anti-BIRC7/LIVIN antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
L9544 Anti-Livin (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, western blot pricing
L9669 Anti-Livin (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, western blot pricing
L9794 Anti-Livin α antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, western blot pricing
PRS2505 Anti-Livin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500598 Anti-LIVIN/BIRC7 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1403365 Monoclonal Anti-BIRC7, (N-terminal) antibody produced in mouse clone 3H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU176031 MISSION® esiRNA esiRNA targeting mouse Birc7 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022161 Rosetta Predictions human pricing
NM_139317 Rosetta Predictions human pricing
XM_001058257 Rosetta Predictions rat pricing
XM_238302 Rosetta Predictions rat pricing
XM_283820 Rosetta Predictions mouse pricing
XM_914797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148385 predicted 433
2 SASI_Hs01_00148386 predicted 591
3 SASI_Hs01_00148387 predicted 432
4 SASI_Hs01_00148388 predicted 228
5 SASI_Hs01_00148389 predicted 219
6 SASI_Hs01_00148390 predicted 431
7 SASI_Hs01_00148391 predicted 523
8 SASI_Hs01_00148392 predicted 461
9 SASI_Hs01_00148393 predicted 226
10 SASI_Hs01_00148394 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119417 predicted 433
2 SASI_Hs01_00119418 predicted 591
3 SASI_Hs01_00119419 predicted 441
4 SASI_Hs01_00119420 predicted 231
5 SASI_Hs01_00119421 predicted 221
6 SASI_Hs01_00119422 predicted 433
7 SASI_Hs01_00119423 predicted 526
8 SASI_Hs01_00119424 predicted 459
9 SASI_Hs01_00119425 predicted 234
10 SASI_Hs01_00119426 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289129 predicted 428
2 SASI_Rn02_00289130 predicted 766
3 SASI_Rn02_00289131 predicted 564
4 SASI_Rn02_00289132 predicted 717
5 SASI_Rn02_00289133 predicted 273
6 SASI_Rn02_00289134 predicted 332
7 SASI_Rn02_00289135 predicted 520
8 SASI_Rn02_00289136 predicted 580
9 SASI_Rn02_00289137 predicted 242
10 SASI_Rn02_00289138 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391306 predicted 662
2 SASI_Rn02_00391307 predicted 674
3 SASI_Rn02_00391308 predicted 464
4 SASI_Rn02_00391309 predicted 618
5 SASI_Rn02_00391310 predicted 617
6 SASI_Rn02_00391311 predicted 464
7 SASI_Rn02_00391312 predicted 656
8 SASI_Rn02_00391313 predicted 417
9 SASI_Rn02_00391314 predicted 482
10 SASI_Rn02_00391315 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246342 predicted 233
2 SASI_Mm01_00246343 predicted 656
3 SASI_Mm01_00246344 predicted 319
4 SASI_Mm01_00246346 predicted 422
5 SASI_Mm01_00246347 predicted 218
6 SASI_Mm01_00246348 predicted 510
7 SASI_Mm01_00246349 predicted 368
8 SASI_Mm01_00246350 predicted 365
9 SASI_Mm02_00425626 predicted 655
10 SASI_Mm01_00246351 predicted 420
11 SASI_Mm01_00246345 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438903 predicted 238
2 SASI_Mm02_00438904 predicted 652
3 SASI_Mm02_00438905 predicted 314
4 SASI_Mm02_00438906 predicted 420
5 SASI_Mm02_00438907 predicted 217
6 SASI_Mm02_00438908 predicted 517
7 SASI_Mm02_00438909 predicted 364
8 SASI_Mm02_00438910 predicted 367
9 SASI_Mm02_00438911 predicted 661
10 SASI_Mm02_00438912 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022161
BIRC7 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-857s1c1
Sequence:CCGGGCAGGAGGAGAGGACGTGCAACTCGAGTTGCACGTCCTCTCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-786s1c1
Sequence:CCGGAGGAGAGAGGTCCAGTCTGAACTCGAGTTCAGACTGGACCTCTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-283s1c1
Sequence:CCGGGCCCTGTCCTAGGCCTGGACACTCGAGTGTCCAGGCCTAGGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-893s1c1
Sequence:CCGGCGCCGTGTCCATCGTCTTTGTCTCGAGACAAAGACGATGGACACGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-530s21c1
Sequence:CCGGGGACAAGGTGAGGTGCTTCTTCTCGAGAAGAAGCACCTCACCTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-788s21c1
Sequence:CCGGGAGAGAGGTCCAGTCTGAAAGCTCGAGCTTTCAGACTGGACCTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022161.2-1075s21c1
Sequence:CCGGTGTTCTGGACTGTGTTCTGGGCTCGAGCCCAGAACACAGTCCAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-626s21c1
Sequence:CCGGTCAGTTCCTGCTCCGGTCAAACTCGAGTTTGACCGGAGCAGGAACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-438s21c1
Sequence:CCGGTTGCGTCTGGCCTCCTTCTATCTCGAGATAGAAGGAGGCCAGACGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022161
BIRC7 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-857s1c1
Sequence:CCGGGCAGGAGGAGAGGACGTGCAACTCGAGTTGCACGTCCTCTCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-786s1c1
Sequence:CCGGAGGAGAGAGGTCCAGTCTGAACTCGAGTTCAGACTGGACCTCTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-283s1c1
Sequence:CCGGGCCCTGTCCTAGGCCTGGACACTCGAGTGTCCAGGCCTAGGACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-893s1c1
Sequence:CCGGCGCCGTGTCCATCGTCTTTGTCTCGAGACAAAGACGATGGACACGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-530s21c1
Sequence:CCGGGGACAAGGTGAGGTGCTTCTTCTCGAGAAGAAGCACCTCACCTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-788s21c1
Sequence:CCGGGAGAGAGGTCCAGTCTGAAAGCTCGAGCTTTCAGACTGGACCTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022161.2-1075s21c1
Sequence:CCGGTGTTCTGGACTGTGTTCTGGGCTCGAGCCCAGAACACAGTCCAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-626s21c1
Sequence:CCGGTCAGTTCCTGCTCCGGTCAAACTCGAGTTTGACCGGAGCAGGAACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-438s21c1
Sequence:CCGGTTGCGTCTGGCCTCCTTCTATCTCGAGATAGAAGGAGGCCAGACGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022161
BIRC7 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-857s1c1
Sequence:CCGGGCAGGAGGAGAGGACGTGCAACTCGAGTTGCACGTCCTCTCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-786s1c1
Sequence:CCGGAGGAGAGAGGTCCAGTCTGAACTCGAGTTCAGACTGGACCTCTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-283s1c1
Sequence:CCGGGCCCTGTCCTAGGCCTGGACACTCGAGTGTCCAGGCCTAGGACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022161.2-893s1c1
Sequence:CCGGCGCCGTGTCCATCGTCTTTGTCTCGAGACAAAGACGATGGACACGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-530s21c1
Sequence:CCGGGGACAAGGTGAGGTGCTTCTTCTCGAGAAGAAGCACCTCACCTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-788s21c1
Sequence:CCGGGAGAGAGGTCCAGTCTGAAAGCTCGAGCTTTCAGACTGGACCTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022161.2-1075s21c1
Sequence:CCGGTGTTCTGGACTGTGTTCTGGGCTCGAGCCCAGAACACAGTCCAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-626s21c1
Sequence:CCGGTCAGTTCCTGCTCCGGTCAAACTCGAGTTTGACCGGAGCAGGAACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022161.2-438s21c1
Sequence:CCGGTTGCGTCTGGCCTCCTTCTATCTCGAGATAGAAGGAGGCCAGACGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163247
BIRC7 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-497s21c1
Sequence:CCGGCAGGACAAGGTGAGATGTTTCCTCGAGGAAACATCTCACCTTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-238s21c1
Sequence:CCGGCCGCACACAGGAACAGGATAACTCGAGTTATCCTGTTCCTGTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-297s21c1
Sequence:CCGGGCCTAGATGGGCAGATCTTAGCTCGAGCTAAGATCTGCCCATCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-963s21c1
Sequence:CCGGTACGCACATTCCTGTCCTAAACTCGAGTTTAGGACAGGAATGTGCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163247.1-985s21c1
Sequence:CCGGCAGGAACTACACTGCAGAGTGCTCGAGCACTCTGCAGTGTAGTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163247
BIRC7 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-497s21c1
Sequence:CCGGCAGGACAAGGTGAGATGTTTCCTCGAGGAAACATCTCACCTTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-238s21c1
Sequence:CCGGCCGCACACAGGAACAGGATAACTCGAGTTATCCTGTTCCTGTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-297s21c1
Sequence:CCGGGCCTAGATGGGCAGATCTTAGCTCGAGCTAAGATCTGCCCATCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-963s21c1
Sequence:CCGGTACGCACATTCCTGTCCTAAACTCGAGTTTAGGACAGGAATGTGCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163247.1-985s21c1
Sequence:CCGGCAGGAACTACACTGCAGAGTGCTCGAGCACTCTGCAGTGTAGTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163247
BIRC7 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-497s21c1
Sequence:CCGGCAGGACAAGGTGAGATGTTTCCTCGAGGAAACATCTCACCTTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-238s21c1
Sequence:CCGGCCGCACACAGGAACAGGATAACTCGAGTTATCCTGTTCCTGTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-297s21c1
Sequence:CCGGGCCTAGATGGGCAGATCTTAGCTCGAGCTAAGATCTGCCCATCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163247.1-963s21c1
Sequence:CCGGTACGCACATTCCTGTCCTAAACTCGAGTTTAGGACAGGAATGTGCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163247.1-985s21c1
Sequence:CCGGCAGGAACTACACTGCAGAGTGCTCGAGCACTCTGCAGTGTAGTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)