EMAIL THIS PAGE TO A FRIEND

BIRC8

baculoviral IAP repeat containing 8

30 Gene Product Result for
Synonyms: ILP-2 ILP2 hILP2
Species: Human BIRC8(112401)
UniProtKB ID: Q96P09, Q6IPY1, Q96RW5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033341 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029371 MISSION® esiRNA esiRNA human BIRC8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033341 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217919 predicted 1600
2 SASI_Hs01_00217922 predicted 1279
3 SASI_Hs01_00217923 predicted 1646
4 SASI_Hs01_00217924 predicted 1563
5 SASI_Hs01_00217925 predicted 1326
6 SASI_Hs01_00217926 predicted 1695
7 SASI_Hs01_00217928 predicted 1706
8 SASI_Hs02_00361190 predicted 1571
9 SASI_Hs02_00361191 predicted 1391
10 SASI_Hs02_00361192 predicted 1250
11 SASI_Hs01_00217920 predicted 1618
12 SASI_Hs01_00217921 predicted 1582
13 SASI_Hs01_00217927 predicted 1441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033341
BIRC8 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1289s21c1
Sequence:CCGGGGATGTACTCCGTTAACAAAGCTCGAGCTTTGTTAACGGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1657s21c1
Sequence:CCGGCAAACATCTGGGAGCAACTATCTCGAGATAGTTGCTCCCAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1487s21c1
Sequence:CCGGACATTCATTTAACCCGTTCACCTCGAGGTGAACGGGTTAAATGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1714s1c1
Sequence:CCGGGCTCAGAAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1579s1c1
Sequence:CCGGCCTAATCCTATGCTACAAGAACTCGAGTTCTTGTAGCATAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1600s1c1
Sequence:CCGGGCTATACGAATGGGATTTGATCTCGAGATCAAATCCCATTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1828s1c1
Sequence:CCGGGACAGACATATCGCTGTTGTTCTCGAGAACAACAGCGATATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1348s1c1
Sequence:CCGGGAGGATAAAGTACAGTGCTTTCTCGAGAAAGCACTGTACTTTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033341
BIRC8 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1289s21c1
Sequence:CCGGGGATGTACTCCGTTAACAAAGCTCGAGCTTTGTTAACGGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1657s21c1
Sequence:CCGGCAAACATCTGGGAGCAACTATCTCGAGATAGTTGCTCCCAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1487s21c1
Sequence:CCGGACATTCATTTAACCCGTTCACCTCGAGGTGAACGGGTTAAATGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1714s1c1
Sequence:CCGGGCTCAGAAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1579s1c1
Sequence:CCGGCCTAATCCTATGCTACAAGAACTCGAGTTCTTGTAGCATAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1600s1c1
Sequence:CCGGGCTATACGAATGGGATTTGATCTCGAGATCAAATCCCATTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1828s1c1
Sequence:CCGGGACAGACATATCGCTGTTGTTCTCGAGAACAACAGCGATATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1348s1c1
Sequence:CCGGGAGGATAAAGTACAGTGCTTTCTCGAGAAAGCACTGTACTTTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033341
BIRC8 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1289s21c1
Sequence:CCGGGGATGTACTCCGTTAACAAAGCTCGAGCTTTGTTAACGGAGTACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1657s21c1
Sequence:CCGGCAAACATCTGGGAGCAACTATCTCGAGATAGTTGCTCCCAGATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033341.3-1487s21c1
Sequence:CCGGACATTCATTTAACCCGTTCACCTCGAGGTGAACGGGTTAAATGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1714s1c1
Sequence:CCGGGCTCAGAAAGACACTACAGAACTCGAGTTCTGTAGTGTCTTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1579s1c1
Sequence:CCGGCCTAATCCTATGCTACAAGAACTCGAGTTCTTGTAGCATAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1600s1c1
Sequence:CCGGGCTATACGAATGGGATTTGATCTCGAGATCAAATCCCATTCGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1828s1c1
Sequence:CCGGGACAGACATATCGCTGTTGTTCTCGAGAACAACAGCGATATGTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033341.3-1348s1c1
Sequence:CCGGGAGGATAAAGTACAGTGCTTTCTCGAGAAAGCACTGTACTTTATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks