EMAIL THIS PAGE TO A FRIEND

BIVM

basic, immunoglobulin-like variable motif containing

UniProtKB ID: Q86UB2, Q2M1J2, Q9NXM4
Gene ID:
Mouse(246229) basic, immunoglobulin-like variable motif containing
Rat(316371) basic, immunoglobulin-like variable motif containing
naked mole-rat(101698549) basic, immunoglobulin-like variable motif containing
domestic guinea pig(101788111) basic, immunoglobulin-like variable motif containing
sheep(101114284) basic, immunoglobulin-like variable motif containing
Domestic Rabbit(100338564) basic, immunoglobulin-like variable motif containing
Zebrafish(555455) basic, immunoglobulin-like variable motif containing
dog(485539) basic, immunoglobulin-like variable motif containing
cow(532455) basic, immunoglobulin-like variable motif containing
domestic cat(101083137) basic, immunoglobulin-like variable motif containing
chicken(374099) basic, immunoglobulin-like variable motif containing
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011921 MISSION® esiRNA esiRNA targeting human BIVM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017693 Rosetta Predictions human pricing
XM_237103 Rosetta Predictions rat pricing
NM_144558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025039 predicted 1594
2 SASI_Hs01_00025040 predicted 2227
3 SASI_Hs01_00025042 predicted 2163
4 SASI_Hs01_00025043 predicted 818
5 SASI_Hs01_00025044 predicted 1399
6 SASI_Hs01_00025045 predicted 1417
7 SASI_Hs02_00350446 predicted 1749
8 SASI_Hs01_00025046 predicted 2239
9 SASI_Hs01_00025047 predicted 1289
10 SASI_Hs01_00025048 predicted 1009
11 SASI_Hs01_00025041 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162186 predicted 893
2 SASI_Rn01_00162187 predicted 331
3 SASI_Rn01_00162188 predicted 670
4 SASI_Rn01_00162189 predicted 328
5 SASI_Rn01_00162190 predicted 733
6 SASI_Rn01_00162191 predicted 911
7 SASI_Rn01_00162192 predicted 438
8 SASI_Rn01_00162193 predicted 842
9 SASI_Rn01_00162194 predicted 717
10 SASI_Rn01_00162195 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022666 predicted 974
2 SASI_Mm01_00022667 predicted 1064
3 SASI_Mm02_00340112 predicted 1554
4 SASI_Mm02_00340113 predicted 1647
5 SASI_Mm01_00022669 predicted 761
6 SASI_Mm01_00022670 predicted 848
7 SASI_Mm01_00022672 predicted 1009
8 SASI_Mm01_00022673 predicted 893
9 SASI_Mm01_00022674 predicted 1738
10 SASI_Mm02_00340114 predicted 1564
11 SASI_Mm01_00022665 predicted 1869
12 SASI_Mm01_00022668 predicted 1228
13 SASI_Mm01_00022671 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017693
BIVM MISSION shRNA Bacterial Glycerol Stock
basic, immunoglobulin-like variable motif containing
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1301s1c1
Sequence:CCGGCCACAGTATAAGACTTCTTGTCTCGAGACAAGAAGTCTTATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1605s1c1
Sequence:CCGGCCCGTGGATTGAAAGATGAATCTCGAGATTCATCTTTCAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017693.2-2836s1c1
Sequence:CCGGCCGTCTCTACTAAACATACAACTCGAGTTGTATGTTTAGTAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1406s1c1
Sequence:CCGGGCTTTACATATTCTGGGCTTTCTCGAGAAAGCCCAGAATATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017693.3-1808s21c1
Sequence:CCGGGATATTGTTACTGATCTAAACCTCGAGGTTTAGATCAGTAACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017693.3-2202s21c1
Sequence:CCGGTACTGAACAGCTGGCATTATACTCGAGTATAATGCCAGCTGTTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017693
BIVM MISSION shRNA shRNA Plasmid DNA
basic, immunoglobulin-like variable motif containing
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1301s1c1
Sequence:CCGGCCACAGTATAAGACTTCTTGTCTCGAGACAAGAAGTCTTATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1605s1c1
Sequence:CCGGCCCGTGGATTGAAAGATGAATCTCGAGATTCATCTTTCAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017693.2-2836s1c1
Sequence:CCGGCCGTCTCTACTAAACATACAACTCGAGTTGTATGTTTAGTAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1406s1c1
Sequence:CCGGGCTTTACATATTCTGGGCTTTCTCGAGAAAGCCCAGAATATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017693.3-1808s21c1
Sequence:CCGGGATATTGTTACTGATCTAAACCTCGAGGTTTAGATCAGTAACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017693.3-2202s21c1
Sequence:CCGGTACTGAACAGCTGGCATTATACTCGAGTATAATGCCAGCTGTTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017693
BIVM MISSION shRNA Lentiviral Transduction Particles
basic, immunoglobulin-like variable motif containing
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1301s1c1
Sequence:CCGGCCACAGTATAAGACTTCTTGTCTCGAGACAAGAAGTCTTATACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1605s1c1
Sequence:CCGGCCCGTGGATTGAAAGATGAATCTCGAGATTCATCTTTCAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017693.2-2836s1c1
Sequence:CCGGCCGTCTCTACTAAACATACAACTCGAGTTGTATGTTTAGTAGAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017693.2-1406s1c1
Sequence:CCGGGCTTTACATATTCTGGGCTTTCTCGAGAAAGCCCAGAATATGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017693.3-1808s21c1
Sequence:CCGGGATATTGTTACTGATCTAAACCTCGAGGTTTAGATCAGTAACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017693.3-2202s21c1
Sequence:CCGGTACTGAACAGCTGGCATTATACTCGAGTATAATGCCAGCTGTTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144558
VALIDATED
BIVM MISSION shRNA Bacterial Glycerol Stock
basic, immunoglobulin-like variable motif containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000175161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1342s1c1
Sequence:CCGGGCTTATATCTATCATTGCCAACTCGAGTTGGCAATGATAGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144558.2-949s1c1
Sequence:CCGGCCTCTTGATGATGTTAAACAACTCGAGTTGTTTAACATCATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1173s1c1
Sequence:CCGGCACTGGAAATACAACACTCATCTCGAGATGAGTGTTGTATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-625s1c2
Sequence:CCGGCAGGCAACATCAGTCTACAAACTCGAGTTTGTAGACTGATGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144558
VALIDATED
BIVM MISSION shRNA shRNA Plasmid DNA
basic, immunoglobulin-like variable motif containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000175161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1342s1c1
Sequence:CCGGGCTTATATCTATCATTGCCAACTCGAGTTGGCAATGATAGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144558.2-949s1c1
Sequence:CCGGCCTCTTGATGATGTTAAACAACTCGAGTTGTTTAACATCATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1173s1c1
Sequence:CCGGCACTGGAAATACAACACTCATCTCGAGATGAGTGTTGTATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-625s1c2
Sequence:CCGGCAGGCAACATCAGTCTACAAACTCGAGTTTGTAGACTGATGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144558
VALIDATED
BIVM MISSION shRNA Lentiviral Transduction Particles
basic, immunoglobulin-like variable motif containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000175161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1342s1c1
Sequence:CCGGGCTTATATCTATCATTGCCAACTCGAGTTGGCAATGATAGATATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144558.2-949s1c1
Sequence:CCGGCCTCTTGATGATGTTAAACAACTCGAGTTGTTTAACATCATCAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-1173s1c1
Sequence:CCGGCACTGGAAATACAACACTCATCTCGAGATGAGTGTTGTATTTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144558.2-625s1c2
Sequence:CCGGCAGGCAACATCAGTCTACAAACTCGAGTTTGTAGACTGATGTTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks