EMAIL THIS PAGE TO A FRIEND

BLCAP

bladder cancer associated protein

181 Gene Product Result for
Synonyms: BC10
UniProtKB ID: P62952, A2A2K7, O60629, Q9D3B5
Gene ID:
Human(10904) Summary: This gene encodes a tumor suppressor protein that reduces cell growth by stimulating apoptosis. The first intron of this gene contains the neuronatin gene, which is imprinted and only expressed from the paternal allele. This gene is imprinted in brain where it is differentially expressed from different promoters. Transcription from the upstream promoter occurs preferentially on the maternal allele, and transcripts are preferentially expressed from the downstream promoter on the paternal allele. Alternative promoters and alternative splicing result in multiple transcript variants that encode the same protein.[provided by RefSeq, Nov 2009]
Mouse(53619) bladder cancer associated protein homolog (human)
Rat(171113) bladder cancer associated protein
Zebrafish(57918) bladder cancer associated protein
dog(100685444) bladder cancer associated protein
domestic cat(493843) bladder cancer associated protein
cow(281649) bladder cancer associated protein
chicken(100857695) bladder cancer associated protein
naked mole-rat(101702642) bladder cancer associated protein
domestic guinea pig(100728970) bladder cancer associated protein
sheep(101103339) bladder cancer associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006698 Rosetta Predictions human pricing
NM_133582 Rosetta Predictions rat pricing
NM_016916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055162 predicted 410
2 SASI_Hs01_00055163 predicted 1017
3 SASI_Hs01_00055164 predicted 471
4 SASI_Hs02_00342119 predicted 1046
5 SASI_Hs01_00055165 predicted 436
6 SASI_Hs01_00055166 predicted 399
7 SASI_Hs02_00342120 predicted 927
8 SASI_Hs01_00055168 predicted 594
9 SASI_Hs02_00342121 predicted 561
10 SASI_Hs01_00055169 predicted 476
11 SASI_Hs01_00055167 predicted 366
12 SASI_Hs01_00055170 predicted 611
13 SASI_Hs01_00055171 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102323 predicted 371
2 SASI_Rn01_00102324 predicted 519
3 SASI_Rn01_00102325 predicted 510
4 SASI_Rn01_00102326 predicted 437
5 SASI_Rn01_00102327 predicted 382
6 SASI_Rn01_00102328 predicted 553
7 SASI_Rn01_00102330 predicted 843
8 SASI_Rn01_00102331 predicted 701
9 SASI_Rn01_00102332 predicted 988
10 SASI_Rn02_00267781 predicted 869
11 SASI_Rn01_00102329 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123242 predicted 538
2 SASI_Mm02_00323777 predicted 888
3 SASI_Mm01_00123243 predicted 870
4 SASI_Mm01_00123244 predicted 734
5 SASI_Mm01_00123246 predicted 542
6 SASI_Mm01_00123247 predicted 749
7 SASI_Mm01_00123248 predicted 591
8 SASI_Mm01_00123249 predicted 859
9 SASI_Mm01_00123250 predicted 886
10 SASI_Mm01_00123251 predicted 648
11 SASI_Mm01_00123245 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006698
BLCAP MISSION shRNA Bacterial Glycerol Stock
bladder cancer associated protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-379s21c1
Sequence:CCGGTGGTTCAGCCACTCCATGTTCCTCGAGGAACATGGAGTGGCTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006698.3-627s21c1
Sequence:CCGGGCATTGACATAGGTCATAAAGCTCGAGCTTTATGACCTATGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-579s21c1
Sequence:CCCGACGGCCTGCCCTGTTAGCTTTCTCGAGAAAGCTAACAGGGCAGGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-411s1c1
Sequence:CCGGGCCCTGTTCCTTATCTGCTATCTCGAGATAGCAGATAAGGAACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006698.2-1697s1c1
Sequence:CCGGGCGCATATAGACTGTACATTACTCGAGTAATGTACAGTCTATATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-382s1c1
Sequence:CCGGGCACAATTTGTGCCTTGGTTTCTCGAGAAACCAAGGCACAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-442s1c1
Sequence:CCGGGAAACTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-412s1c1
Sequence:CCGGCCCTGTTCCTTATCTGCTATACTCGAGTATAGCAGATAAGGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-369s1c1
Sequence:CCGGGAACGGAAGCCTTGCACAATTCTCGAGAATTGTGCAAGGCTTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006698
BLCAP MISSION shRNA shRNA Plasmid DNA
bladder cancer associated protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-379s21c1
Sequence:CCGGTGGTTCAGCCACTCCATGTTCCTCGAGGAACATGGAGTGGCTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006698.3-627s21c1
Sequence:CCGGGCATTGACATAGGTCATAAAGCTCGAGCTTTATGACCTATGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-579s21c1
Sequence:CCCGACGGCCTGCCCTGTTAGCTTTCTCGAGAAAGCTAACAGGGCAGGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-411s1c1
Sequence:CCGGGCCCTGTTCCTTATCTGCTATCTCGAGATAGCAGATAAGGAACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006698.2-1697s1c1
Sequence:CCGGGCGCATATAGACTGTACATTACTCGAGTAATGTACAGTCTATATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-382s1c1
Sequence:CCGGGCACAATTTGTGCCTTGGTTTCTCGAGAAACCAAGGCACAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-442s1c1
Sequence:CCGGGAAACTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-412s1c1
Sequence:CCGGCCCTGTTCCTTATCTGCTATACTCGAGTATAGCAGATAAGGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-369s1c1
Sequence:CCGGGAACGGAAGCCTTGCACAATTCTCGAGAATTGTGCAAGGCTTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006698
BLCAP MISSION shRNA Lentiviral Transduction Particles
bladder cancer associated protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-379s21c1
Sequence:CCGGTGGTTCAGCCACTCCATGTTCCTCGAGGAACATGGAGTGGCTGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006698.3-627s21c1
Sequence:CCGGGCATTGACATAGGTCATAAAGCTCGAGCTTTATGACCTATGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006698.3-579s21c1
Sequence:CCCGACGGCCTGCCCTGTTAGCTTTCTCGAGAAAGCTAACAGGGCAGGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-411s1c1
Sequence:CCGGGCCCTGTTCCTTATCTGCTATCTCGAGATAGCAGATAAGGAACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006698.2-1697s1c1
Sequence:CCGGGCGCATATAGACTGTACATTACTCGAGTAATGTACAGTCTATATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-382s1c1
Sequence:CCGGGCACAATTTGTGCCTTGGTTTCTCGAGAAACCAAGGCACAAATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-442s1c1
Sequence:CCGGGAAACTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-412s1c1
Sequence:CCGGCCCTGTTCCTTATCTGCTATACTCGAGTATAGCAGATAAGGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006698.1-369s1c1
Sequence:CCGGGAACGGAAGCCTTGCACAATTCTCGAGAATTGTGCAAGGCTTCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016916
BLCAP MISSION shRNA Bacterial Glycerol Stock
bladder cancer associated protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016916.2-1378s1c1
Sequence:CCGGGCTGAGTGAATGAGAAAGTATCTCGAGATACTTTCTCATTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-506s1c1
Sequence:CCGGGAAATTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-433s1c1
Sequence:CCGGGAACGGAAACCTTGCACAATACTCGAGTATTGTGCAAGGTTTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-446s1c1
Sequence:CCGGGCACAATATGTGCCTTGGTTTCTCGAGAAACCAAGGCACATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-476s1c1
Sequence:CCGGCCCTCTTTCTCATCTGCTATACTCGAGTATAGCAGATGAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016916
BLCAP MISSION shRNA shRNA Plasmid DNA
bladder cancer associated protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016916.2-1378s1c1
Sequence:CCGGGCTGAGTGAATGAGAAAGTATCTCGAGATACTTTCTCATTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-506s1c1
Sequence:CCGGGAAATTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-433s1c1
Sequence:CCGGGAACGGAAACCTTGCACAATACTCGAGTATTGTGCAAGGTTTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-446s1c1
Sequence:CCGGGCACAATATGTGCCTTGGTTTCTCGAGAAACCAAGGCACATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-476s1c1
Sequence:CCGGCCCTCTTTCTCATCTGCTATACTCGAGTATAGCAGATGAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016916
BLCAP MISSION shRNA Lentiviral Transduction Particles
bladder cancer associated protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016916.2-1378s1c1
Sequence:CCGGGCTGAGTGAATGAGAAAGTATCTCGAGATACTTTCTCATTCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-506s1c1
Sequence:CCGGGAAATTGTTTCCTGTACCACTCTCGAGAGTGGTACAGGAAACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-433s1c1
Sequence:CCGGGAACGGAAACCTTGCACAATACTCGAGTATTGTGCAAGGTTTCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-446s1c1
Sequence:CCGGGCACAATATGTGCCTTGGTTTCTCGAGAAACCAAGGCACATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016916.2-476s1c1
Sequence:CCGGCCCTCTTTCTCATCTGCTATACTCGAGTATAGCAGATGAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks