EMAIL THIS PAGE TO A FRIEND

BLID

BH3-like motif containing, cell death inducer

27 Gene Product Result for
Synonyms: BRCC2
Species: Human BLID(414899)
UniProtKB ID: Q8IZY5, A1L416
Gene ID:
Human(414899) Summary: This gene encodes a BH3-like motif containing protein involved in cell death. The encoded protein may induce apoptosis in a caspase-dependent manner. The protein is localized in both the cytoplasm and the mitochondrion. [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0414899M5 Monoclonal Anti-BRCC2 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001786 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029118 predicted 575
2 SASI_Hs01_00029119 predicted 628
3 SASI_Hs01_00029120 predicted 355
4 SASI_Hs01_00029121 predicted 547
5 SASI_Hs01_00029124 predicted 557
6 SASI_Hs01_00029125 predicted 636
7 SASI_Hs02_00303925 predicted 580
8 SASI_Hs01_00029126 predicted 453
9 SASI_Hs02_00303926 predicted 473
10 SASI_Hs02_00303927 predicted 387
11 SASI_Hs01_00029122 predicted 578
12 SASI_Hs01_00029123 predicted 306
13 SASI_Hs01_00029127 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001786
BLID MISSION shRNA Bacterial Glycerol Stock
BH3-like motif containing, cell death inducer
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-339s1c1
Sequence:CCGGGAGATCCTAGAATCTGAGTGTCTCGAGACACTCAGATTCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-455s1c1
Sequence:CCGGCAAAGAACCTATGTTGCCTAACTCGAGTTAGGCAACATAGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001786.1-656s21c1
Sequence:CCGGGGACAGATTTCGCCCATTATTCTCGAGAATAATGGGCGAAATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-449s21c1
Sequence:CCGGTTCCAACAAAGAACCTATGTTCTCGAGAACATAGGTTCTTTGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-387s21c1
Sequence:CCGGGCCTCTGGCAGTTCCATTTATCTCGAGATAAATGGAACTGCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-566s21c1
Sequence:CCGGTTTAACCAGGATACAAGTTACCTCGAGGTAACTTGTATCCTGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-516s21c1
Sequence:CCGGTCTGCCATGAAGCGGAATGTTCTCGAGAACATTCCGCTTCATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001786
BLID MISSION shRNA shRNA Plasmid DNA
BH3-like motif containing, cell death inducer
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-339s1c1
Sequence:CCGGGAGATCCTAGAATCTGAGTGTCTCGAGACACTCAGATTCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-455s1c1
Sequence:CCGGCAAAGAACCTATGTTGCCTAACTCGAGTTAGGCAACATAGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001786.1-656s21c1
Sequence:CCGGGGACAGATTTCGCCCATTATTCTCGAGAATAATGGGCGAAATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-449s21c1
Sequence:CCGGTTCCAACAAAGAACCTATGTTCTCGAGAACATAGGTTCTTTGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-387s21c1
Sequence:CCGGGCCTCTGGCAGTTCCATTTATCTCGAGATAAATGGAACTGCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-566s21c1
Sequence:CCGGTTTAACCAGGATACAAGTTACCTCGAGGTAACTTGTATCCTGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-516s21c1
Sequence:CCGGTCTGCCATGAAGCGGAATGTTCTCGAGAACATTCCGCTTCATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001786
BLID MISSION shRNA Lentiviral Transduction Particles
BH3-like motif containing, cell death inducer
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-339s1c1
Sequence:CCGGGAGATCCTAGAATCTGAGTGTCTCGAGACACTCAGATTCTAGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001786.1-455s1c1
Sequence:CCGGCAAAGAACCTATGTTGCCTAACTCGAGTTAGGCAACATAGGTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001786.1-656s21c1
Sequence:CCGGGGACAGATTTCGCCCATTATTCTCGAGAATAATGGGCGAAATCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-449s21c1
Sequence:CCGGTTCCAACAAAGAACCTATGTTCTCGAGAACATAGGTTCTTTGTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-387s21c1
Sequence:CCGGGCCTCTGGCAGTTCCATTTATCTCGAGATAAATGGAACTGCCAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-566s21c1
Sequence:CCGGTTTAACCAGGATACAAGTTACCTCGAGGTAACTTGTATCCTGGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001786.1-516s21c1
Sequence:CCGGTCTGCCATGAAGCGGAATGTTCTCGAGAACATTCCGCTTCATGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks