EMAIL THIS PAGE TO A FRIEND

BLK

B lymphoid tyrosine kinase

110 Gene Product Result for
Synonyms: MODY11
UniProtKB ID: P51451, Q16291, Q96IN1
Gene ID:
Human(640) Summary: This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]
Mouse(12143) B lymphoid kinase
Rat(364403) B lymphoid tyrosine kinase
Zebrafish(567764) B lymphoid tyrosine kinase
domestic cat(101084104) B lymphoid tyrosine kinase
cow(532587) B lymphoid tyrosine kinase
Horse(100065099) B lymphoid tyrosine kinase
dog(486080) B lymphoid tyrosine kinase
chicken(422035) B lymphoid tyrosine kinase
sheep(101111167) B lymphoid tyrosine kinase
domestic guinea pig(100714723) B lymphoid tyrosine kinase
naked mole-rat(101707209) B lymphoid tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B0437 Anti-BLK (121-135) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501622 Anti-BLK (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1409646 Anti-BLK antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV46061 Anti-BLK antibody produced in rabbit IgG fraction of antiserum bovine, human, mouse, rabbit, canine, guinea pig, horse, rat
western blot pricing
SAB1411244 Anti-BLK antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB4301289 Anti-phospho-BLK (pTyr501) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
WH0000640M2 Monoclonal Anti-BLK antibody produced in mouse clone 7A12, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1403607 Monoclonal Anti-BLK antibody produced in mouse clone 3E5-3A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300506 Monoclonal Anti-BLK antibody produced in mouse clone 9D10D1, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300507 Monoclonal Anti-BLK antibody produced in mouse clone 9D10B7, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300508 Monoclonal Anti-BLK antibody produced in mouse clone 9D10B7H6, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300509 Monoclonal Anti-BLK antibody produced in mouse clone 1E6, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0936 Phosphotyrosine BLK / Tyrosine-protein Kinase Blk ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001715 Rosetta Predictions human pricing
NM_001025751 Rosetta Predictions rat pricing
NM_007549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221265 predicted 760
2 SASI_Hs02_00332408 predicted 618
3 SASI_Hs01_00221266 predicted 1626
4 SASI_Hs02_00332409 predicted 1318
5 SASI_Hs01_00221267 predicted 1309
6 SASI_Hs01_00221268 predicted 1865
7 SASI_Hs02_00332410 predicted 1603
8 SASI_Hs02_00332411 predicted 618
9 SASI_Hs02_00332412 predicted 1849
10 SASI_Hs01_00221270 predicted 1398
11 SASI_Hs01_00221262 predicted 904
12 SASI_Hs01_00221263 predicted 1721
13 SASI_Hs01_00221264 predicted 1101
14 SASI_Hs01_00221269 predicted 904
15 SASI_Hs01_00221271 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084976 predicted 1909
2 SASI_Rn01_00084977 predicted 496
3 SASI_Rn01_00084978 predicted 641
4 SASI_Rn01_00084979 predicted 1900
5 SASI_Rn01_00084980 predicted 1379
6 SASI_Rn01_00084981 predicted 1894
7 SASI_Rn01_00084982 predicted 1854
8 SASI_Rn01_00084983 predicted 1346
9 SASI_Rn02_00203411 predicted 480
10 SASI_Rn01_00084984 predicted 873
11 SASI_Rn01_00084985 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311904 predicted 1026
2 SASI_Mm02_00311905 predicted 1319
3 SASI_Mm01_00104712 predicted 1973
4 SASI_Mm02_00311906 predicted 1558
5 SASI_Mm01_00104713 predicted 1967
6 SASI_Mm01_00104714 predicted 1120
7 SASI_Mm01_00104715 predicted 548
8 SASI_Mm02_00311907 predicted 638
9 SASI_Mm01_00104716 predicted 1073
10 SASI_Mm01_00104717 predicted 1542
11 SASI_Mm01_00104718 predicted 721
12 SASI_Mm01_00104719 predicted 1557
13 SASI_Mm01_00104720 predicted 549
14 SASI_Mm01_00104721 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001715
VALIDATED
BLK MISSION shRNA Bacterial Glycerol Stock
B lymphoid tyrosine kinase
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1727s21c1
Sequence:CCGGTCGAATCATCGACAGTGAATACTCGAGTATTCACTGTCGATGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1594s21c1
Sequence:CCGGTTGACATGTCGGCGCAGATTGCTCGAGCAATCTGCGCCGACATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-781s21c1
Sequence:CCGGATGACTACACCGCTATGAATGCTCGAGCATTCATAGCGGTGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2384s21c1
Sequence:CCGGACTGGTAAGCGACTGTCATCACTCGAGTGATGACAGTCGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2344s21c1
Sequence:CCGGACGGTCATCCGGAGTACTAAGCTCGAGCTTAGTACTCCGGATGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2297s21c1
Sequence:CCGGCCTCTCTGTGCCGCTTCATTTCTCGAGAAATGAAGCGGCACAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001715.2-1325s1c1
Sequence:CCGGGTCTGGACAATTCGGCGAAGTCTCGAGACTTCGCCGAATTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1095s1c1
Sequence:CCGGGAGCTGATCAAGCACTATAAGCTCGAGCTTATAGTGCTTGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-746s1c1
Sequence:CCGGCCTGGATGAAGACAAGCATTTCTCGAGAAATGCTTGTCTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1854s1c1
Sequence:CCGGCTGATGGAAGTTGTCACTTATCTCGAGATAAGTGACAACTTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1626s1c1
Sequence:CCGGGCATACATTGAGCGCATGAATCTCGAGATTCATGCGCTCAATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1200s1c1
Sequence:CCGGAGATGAAGGGAGCAGATTGTCCTCGAGGACAATCTGCTCCCTTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010086    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-261s1c1
Sequence:CCGGGCCGATCAAAGAGAAGGACAACTCGAGTTGTCCTTCTCTTTGATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1031s1c1
Sequence:CCGGCGCTGAAGGAGGGAACCATGTCTCGAGACATGGTTCCCTCCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010087    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_001715.x-512s1c1
Sequence:CCGGCCAGGTCACTCGTCACAGGAACTCGAGTTCCTGTGACGAGTGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001715
VALIDATED
BLK MISSION shRNA shRNA Plasmid DNA
B lymphoid tyrosine kinase
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1727s21c1
Sequence:CCGGTCGAATCATCGACAGTGAATACTCGAGTATTCACTGTCGATGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1594s21c1
Sequence:CCGGTTGACATGTCGGCGCAGATTGCTCGAGCAATCTGCGCCGACATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-781s21c1
Sequence:CCGGATGACTACACCGCTATGAATGCTCGAGCATTCATAGCGGTGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2384s21c1
Sequence:CCGGACTGGTAAGCGACTGTCATCACTCGAGTGATGACAGTCGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2344s21c1
Sequence:CCGGACGGTCATCCGGAGTACTAAGCTCGAGCTTAGTACTCCGGATGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2297s21c1
Sequence:CCGGCCTCTCTGTGCCGCTTCATTTCTCGAGAAATGAAGCGGCACAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001715.2-1325s1c1
Sequence:CCGGGTCTGGACAATTCGGCGAAGTCTCGAGACTTCGCCGAATTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1095s1c1
Sequence:CCGGGAGCTGATCAAGCACTATAAGCTCGAGCTTATAGTGCTTGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-746s1c1
Sequence:CCGGCCTGGATGAAGACAAGCATTTCTCGAGAAATGCTTGTCTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1854s1c1
Sequence:CCGGCTGATGGAAGTTGTCACTTATCTCGAGATAAGTGACAACTTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1626s1c1
Sequence:CCGGGCATACATTGAGCGCATGAATCTCGAGATTCATGCGCTCAATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1200s1c1
Sequence:CCGGAGATGAAGGGAGCAGATTGTCCTCGAGGACAATCTGCTCCCTTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010086    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-261s1c1
Sequence:CCGGGCCGATCAAAGAGAAGGACAACTCGAGTTGTCCTTCTCTTTGATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1031s1c1
Sequence:CCGGCGCTGAAGGAGGGAACCATGTCTCGAGACATGGTTCCCTCCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010087    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_001715.x-512s1c1
Sequence:CCGGCCAGGTCACTCGTCACAGGAACTCGAGTTCCTGTGACGAGTGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001715
VALIDATED
BLK MISSION shRNA Lentiviral Transduction Particles
B lymphoid tyrosine kinase
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1727s21c1
Sequence:CCGGTCGAATCATCGACAGTGAATACTCGAGTATTCACTGTCGATGATTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-1594s21c1
Sequence:CCGGTTGACATGTCGGCGCAGATTGCTCGAGCAATCTGCGCCGACATGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001715.2-781s21c1
Sequence:CCGGATGACTACACCGCTATGAATGCTCGAGCATTCATAGCGGTGTAGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2384s21c1
Sequence:CCGGACTGGTAAGCGACTGTCATCACTCGAGTGATGACAGTCGCTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2344s21c1
Sequence:CCGGACGGTCATCCGGAGTACTAAGCTCGAGCTTAGTACTCCGGATGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001715.2-2297s21c1
Sequence:CCGGCCTCTCTGTGCCGCTTCATTTCTCGAGAAATGAAGCGGCACAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001715.2-1325s1c1
Sequence:CCGGGTCTGGACAATTCGGCGAAGTCTCGAGACTTCGCCGAATTGTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1095s1c1
Sequence:CCGGGAGCTGATCAAGCACTATAAGCTCGAGCTTATAGTGCTTGATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-746s1c1
Sequence:CCGGCCTGGATGAAGACAAGCATTTCTCGAGAAATGCTTGTCTTCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1854s1c1
Sequence:CCGGCTGATGGAAGTTGTCACTTATCTCGAGATAAGTGACAACTTCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.2-1626s1c1
Sequence:CCGGGCATACATTGAGCGCATGAATCTCGAGATTCATGCGCTCAATGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1200s1c1
Sequence:CCGGAGATGAAGGGAGCAGATTGTCCTCGAGGACAATCTGCTCCCTTCATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010086    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-261s1c1
Sequence:CCGGGCCGATCAAAGAGAAGGACAACTCGAGTTGTCCTTCTCTTTGATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001715.x-1031s1c1
Sequence:CCGGCGCTGAAGGAGGGAACCATGTCTCGAGACATGGTTCCCTCCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010087    
Product Details

Region:5UTR
TRC Version: 1 Clone ID:NM_001715.x-512s1c1
Sequence:CCGGCCAGGTCACTCGTCACAGGAACTCGAGTTCCTGTGACGAGTGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007549
BLK MISSION shRNA Bacterial Glycerol Stock
B lymphoid tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1308s21c1
Sequence:CCGGGGTCACCAGAGAGCCCATTTACTCGAGTAAATGGGCTCTCTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007549.2-1966s21c1
Sequence:CCGGACTCTGACTTTGGGTTAATATCTCGAGATATTAACCCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-916s21c1
Sequence:CCGGGAGGTGGTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1785s21c1
Sequence:CCGGACCGGAGTTGTACAATGATATCTCGAGATATCATTGTACAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-862s1c1
Sequence:CCGGGAGAGCAATAAAGGTGCCTTTCTCGAGAAAGGCACCTTTATTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1783s1c1
Sequence:CCGGCCACCGGAGTTGTACAATGATCTCGAGATCATTGTACAACTCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1558s1c1
Sequence:CCGGGACAGTGAATACACTGCCCAACTCGAGTTGGGCAGTGTATTCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-745s1c1
Sequence:CCGGCCAGTAGAGACTCTGGAAGTACTCGAGTACTTCCAGAGTCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007549
BLK MISSION shRNA shRNA Plasmid DNA
B lymphoid tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1308s21c1
Sequence:CCGGGGTCACCAGAGAGCCCATTTACTCGAGTAAATGGGCTCTCTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007549.2-1966s21c1
Sequence:CCGGACTCTGACTTTGGGTTAATATCTCGAGATATTAACCCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-916s21c1
Sequence:CCGGGAGGTGGTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1785s21c1
Sequence:CCGGACCGGAGTTGTACAATGATATCTCGAGATATCATTGTACAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-862s1c1
Sequence:CCGGGAGAGCAATAAAGGTGCCTTTCTCGAGAAAGGCACCTTTATTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1783s1c1
Sequence:CCGGCCACCGGAGTTGTACAATGATCTCGAGATCATTGTACAACTCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1558s1c1
Sequence:CCGGGACAGTGAATACACTGCCCAACTCGAGTTGGGCAGTGTATTCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-745s1c1
Sequence:CCGGCCAGTAGAGACTCTGGAAGTACTCGAGTACTTCCAGAGTCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007549
BLK MISSION shRNA Lentiviral Transduction Particles
B lymphoid tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1308s21c1
Sequence:CCGGGGTCACCAGAGAGCCCATTTACTCGAGTAAATGGGCTCTCTGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007549.2-1966s21c1
Sequence:CCGGACTCTGACTTTGGGTTAATATCTCGAGATATTAACCCAAAGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-916s21c1
Sequence:CCGGGAGGTGGTCAAGCACTATAAGCTCGAGCTTATAGTGCTTGACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007549.2-1785s21c1
Sequence:CCGGACCGGAGTTGTACAATGATATCTCGAGATATCATTGTACAACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-862s1c1
Sequence:CCGGGAGAGCAATAAAGGTGCCTTTCTCGAGAAAGGCACCTTTATTGCTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1783s1c1
Sequence:CCGGCCACCGGAGTTGTACAATGATCTCGAGATCATTGTACAACTCCGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-1558s1c1
Sequence:CCGGGACAGTGAATACACTGCCCAACTCGAGTTGGGCAGTGTATTCACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007549.2-745s1c1
Sequence:CCGGCCAGTAGAGACTCTGGAAGTACTCGAGTACTTCCAGAGTCTCTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks