EMAIL THIS PAGE TO A FRIEND

BLM

Bloom syndrome, RecQ helicase-like

86 Gene Product Result for
Synonyms: BS RECQ2 RECQL2 RECQL3
UniProtKB ID: P54132, Q52M96
Gene ID:
Human(641) Summary: The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
Mouse(12144) Bloom syndrome, RecQ helicase-like
Rat(308755) Bloom syndrome, RecQ helicase-like
naked mole-rat(101719260) Bloom syndrome, RecQ helicase-like
domestic guinea pig(100732874) Bloom syndrome, RecQ helicase-like
sheep(101107310) Bloom syndrome, RecQ helicase-like
Domestic Rabbit(100345123) Bloom syndrome, RecQ helicase-like
Zebrafish(572540) Bloom syndrome
fruit fly(41366) Bloom syndrome helicase ortholog
domestic cat(101100056) Bloom syndrome, RecQ helicase-like
cow(534148) Bloom syndrome, RecQ helicase-like
Horse(100053387) Bloom syndrome, RecQ helicase-like
dog(100685609) Bloom syndrome, RecQ helicase-like
chicken(415577) Bloom syndrome, RecQ helicase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501962 Anti-BLM (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human
ELISA, western blot pricing
B5061 Anti-Blm antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
HPA005689 Anti-BLM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502734 Anti-Bloom Syndrome, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4504085 Anti-phospho-Bloom Syndrome (pThr99) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301251 Anti-phospho-Bloom Syndrome (pThr99) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
PLA0035 Goat anti-BLM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation, proximity ligation assay, western blot pricing
WH0000641M1 Monoclonal Anti-BLM antibody produced in mouse clone 1E4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0029 Rabbit anti-BLM Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. bovine, gibbon, pig, primate, gorilla, chimpanzee, rhesus monkey, human, mouse, dog
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000057 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000057 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000057 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000057 Rosetta Predictions human pricing
NM_001107526 Rosetta Predictions rat pricing
NM_001042527 Rosetta Predictions mouse pricing
NM_007550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103851 predicted 3625
2 SASI_Hs01_00103853 predicted 2234
3 SASI_Hs01_00103854 predicted 2294
4 SASI_Hs01_00103857 predicted 3593
5 SASI_Hs02_00301769 predicted 4296
6 SASI_Hs01_00103858 predicted 3321
7 SASI_Hs02_00301770 predicted 3358
8 SASI_Hs02_00301771 predicted 817
9 SASI_Hs02_00301772 predicted 3980
10 SASI_Hs01_00103859 predicted 2987
11 SASI_Hs01_00103852 predicted 2385
12 SASI_Hs01_00103855 predicted 4039
13 SASI_Hs01_00103856 predicted 2627
14 SASI_Hs01_00103860 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229695 predicted 889
2 SASI_Rn02_00229696 predicted 1674
3 SASI_Rn02_00229697 predicted 3448
4 SASI_Rn02_00229698 predicted 752
5 SASI_Rn02_00229699 predicted 2571
6 SASI_Rn02_00229700 predicted 784
7 SASI_Rn02_00229701 predicted 2879
8 SASI_Rn02_00229702 predicted 2915
9 SASI_Rn02_00229703 predicted 2600
10 SASI_Rn02_00229704 predicted 3169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290535 predicted 2405
2 SASI_Mm02_00290536 predicted 3554
3 SASI_Mm02_00290537 predicted 4206
4 SASI_Mm02_00290538 predicted 1431
5 SASI_Mm02_00290539 predicted 3592
6 SASI_Mm02_00290540 predicted 2912
7 SASI_Mm02_00290541 predicted 2644
8 SASI_Mm02_00290542 predicted 3122
9 SASI_Mm02_00290543 predicted 3131
10 SASI_Mm02_00290544 predicted 3486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148507 predicted 2671
2 SASI_Mm02_00311908 predicted 3819
3 SASI_Mm02_00311909 predicted 4477
4 SASI_Mm01_00148508 predicted 1699
5 SASI_Mm01_00148509 predicted 3862
6 SASI_Mm01_00148510 predicted 3183
7 SASI_Mm01_00148511 predicted 2915
8 SASI_Mm01_00148512 predicted 3396
9 SASI_Mm01_00148513 predicted 3401
10 SASI_Mm01_00148514 predicted 3750
11 SASI_Mm01_00148515 predicted 3686
12 SASI_Mm01_00148516 predicted 3369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007550
BLM MISSION shRNA Bacterial Glycerol Stock
Bloom syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3186s1c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-1125s1c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-4537s1c1
Sequence:CCGGGCTCCTCCAAAGCCTGTAAATCTCGAGATTTACAGGCTTTGGAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3410s1c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-511s1c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3196s21c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007550.4-4662s21c1
Sequence:CCGGGTTAGTCTTGTTACAGCATTTCTCGAGAAATGCTGTAACAAGACTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-1132s21c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-521s21c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3420s21c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007550
BLM MISSION shRNA shRNA Plasmid DNA
Bloom syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3186s1c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-1125s1c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-4537s1c1
Sequence:CCGGGCTCCTCCAAAGCCTGTAAATCTCGAGATTTACAGGCTTTGGAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3410s1c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-511s1c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3196s21c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007550.4-4662s21c1
Sequence:CCGGGTTAGTCTTGTTACAGCATTTCTCGAGAAATGCTGTAACAAGACTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-1132s21c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-521s21c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3420s21c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007550
BLM MISSION shRNA Lentiviral Transduction Particles
Bloom syndrome, RecQ helicase-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3186s1c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-1125s1c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-4537s1c1
Sequence:CCGGGCTCCTCCAAAGCCTGTAAATCTCGAGATTTACAGGCTTTGGAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-3410s1c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007550.2-511s1c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3196s21c1
Sequence:CCGGCCAGGTTATCTGTGCGACAATCTCGAGATTGTCGCACAGATAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007550.4-4662s21c1
Sequence:CCGGGTTAGTCTTGTTACAGCATTTCTCGAGAAATGCTGTAACAAGACTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-1132s21c1
Sequence:CCGGCCAGTCTTTGAAAGCTCACTTCTCGAGAAGTGAGCTTTCAAAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-521s21c1
Sequence:CCGGCCTGCGTTAAGTGATAAAGATCTCGAGATCTTTATCACTTAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007550.4-3420s21c1
Sequence:CCGGCGAAGGAAACTCACGTCAATACTCGAGTATTGACGTGAGTTTCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000057
VALIDATED
BLM MISSION shRNA Bacterial Glycerol Stock
Bloom syndrome, RecQ helicase-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-1541s1c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-418s1c1
Sequence:CCGGCGAAGGAAGTTGTATGCACTACTCGAGTAGTGCATACAACTTCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-2274s1c1
Sequence:CCGGGCTACATATCTGACAGGTGATCTCGAGATCACCTGTCAGATATGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-523s1c1
Sequence:CCGGCCATCAATGATTGGGATGATACTCGAGTATCATCCCAATCATTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-3578s1c1
Sequence:CCGGCGCTTATGTGATGCTCGGAAACTCGAGTTTCCGAGCATCACATAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000057.2-3429s21c1
Sequence:CCGGTGAATATGCTGGTCGACATTTCTCGAGAAATGTCGACCAGCATATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-4354s21c1
Sequence:CCGGACCGAATCTCAATGTACATAGCTCGAGCTATGTACATTGAGATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1181s21c1
Sequence:CCGGGACGCTAGACAGATAAGTTTACTCGAGTAAACTTATCTGTCTAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1564s21c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-2885s21c1
Sequence:CCGGGTGCAGCAGAAGTGGATTAATCTCGAGATTAATCCACTTCTGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000057
VALIDATED
BLM MISSION shRNA shRNA Plasmid DNA
Bloom syndrome, RecQ helicase-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-1541s1c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-418s1c1
Sequence:CCGGCGAAGGAAGTTGTATGCACTACTCGAGTAGTGCATACAACTTCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-2274s1c1
Sequence:CCGGGCTACATATCTGACAGGTGATCTCGAGATCACCTGTCAGATATGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-523s1c1
Sequence:CCGGCCATCAATGATTGGGATGATACTCGAGTATCATCCCAATCATTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-3578s1c1
Sequence:CCGGCGCTTATGTGATGCTCGGAAACTCGAGTTTCCGAGCATCACATAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000057.2-3429s21c1
Sequence:CCGGTGAATATGCTGGTCGACATTTCTCGAGAAATGTCGACCAGCATATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-4354s21c1
Sequence:CCGGACCGAATCTCAATGTACATAGCTCGAGCTATGTACATTGAGATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1181s21c1
Sequence:CCGGGACGCTAGACAGATAAGTTTACTCGAGTAAACTTATCTGTCTAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1564s21c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-2885s21c1
Sequence:CCGGGTGCAGCAGAAGTGGATTAATCTCGAGATTAATCCACTTCTGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000057
VALIDATED
BLM MISSION shRNA Lentiviral Transduction Particles
Bloom syndrome, RecQ helicase-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-1541s1c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-418s1c1
Sequence:CCGGCGAAGGAAGTTGTATGCACTACTCGAGTAGTGCATACAACTTCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-2274s1c1
Sequence:CCGGGCTACATATCTGACAGGTGATCTCGAGATCACCTGTCAGATATGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000057.1-523s1c1
Sequence:CCGGCCATCAATGATTGGGATGATACTCGAGTATCATCCCAATCATTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000057.1-3578s1c1
Sequence:CCGGCGCTTATGTGATGCTCGGAAACTCGAGTTTCCGAGCATCACATAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000057.2-3429s21c1
Sequence:CCGGTGAATATGCTGGTCGACATTTCTCGAGAAATGTCGACCAGCATATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-4354s21c1
Sequence:CCGGACCGAATCTCAATGTACATAGCTCGAGCTATGTACATTGAGATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1181s21c1
Sequence:CCGGGACGCTAGACAGATAAGTTTACTCGAGTAAACTTATCTGTCTAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-1564s21c1
Sequence:CCGGGCCTTTATTCAATACCCATTTCTCGAGAAATGGGTATTGAATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000057.2-2885s21c1
Sequence:CCGGGTGCAGCAGAAGTGGATTAATCTCGAGATTAATCCACTTCTGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)