EMAIL THIS PAGE TO A FRIEND

BLMH

bleomycin hydrolase

74 Gene Product Result for
Synonyms: BH BMH
UniProtKB ID: Q13867, B2R796, Q53F86, Q9UER9
Gene ID:
Human(642) Summary: Bleomycin hydrolase (BMH) is a cytoplasmic cysteine peptidase that is highly conserved through evolution; however, the only known activity of the enzyme is metabolic inactivation of the glycopeptide bleomycin (BLM), an essential component of combination chemotherapy regimens for cancer. The protein contains the signature active site residues of the cysteine protease papain superfamily. [provided by RefSeq, Jul 2008]
Mouse(104184) bleomycin hydrolase
Rat(287552) bleomycin hydrolase
Zebrafish(336541) bleomycin hydrolase
cow(504483) bleomycin hydrolase
Horse(100072223) bleomycin hydrolase
domestic cat(101090910) bleomycin hydrolase
dog(480635) bleomycin hydrolase
chicken(395996) bleomycin hydrolase
sheep(101111816) bleomycin hydrolase
Domestic Rabbit(100009580) bleomycin hydrolase
domestic guinea pig(100717553) bleomycin hydrolase
naked mole-rat(101706417) bleomycin hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000386 Rosetta Predictions human pricing
NM_001034163 Rosetta Predictions rat pricing
NM_178645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186628 predicted 701
2 SASI_Hs01_00186629 predicted 1524
3 SASI_Hs01_00186630 predicted 867
4 SASI_Hs01_00186632 predicted 556
5 SASI_Hs01_00186633 predicted 305
6 SASI_Hs01_00186634 predicted 680
7 SASI_Hs01_00186635 predicted 1103
8 SASI_Hs01_00186636 predicted 1539
9 SASI_Hs02_00302455 predicted 1483
10 SASI_Hs02_00302456 predicted 780
11 SASI_Hs01_00186627 predicted 726
12 SASI_Hs01_00186631 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085780 predicted 803
2 SASI_Rn01_00085781 predicted 440
3 SASI_Rn02_00204014 predicted 651
4 SASI_Rn02_00204015 predicted 865
5 SASI_Rn01_00085782 predicted 1213
6 SASI_Rn01_00085784 predicted 1039
7 SASI_Rn01_00085785 predicted 834
8 SASI_Rn01_00085786 predicted 823
9 SASI_Rn01_00085787 predicted 1474
10 SASI_Rn01_00085788 predicted 559
11 SASI_Rn01_00085783 predicted 237
12 SASI_Rn01_00085789 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185592 predicted 558
2 SASI_Mm02_00349052 predicted 745
3 SASI_Mm02_00349053 predicted 985
4 SASI_Mm02_00349054 predicted 1082
5 SASI_Mm01_00185596 predicted 982
6 SASI_Mm01_00185597 predicted 862
7 SASI_Mm01_00185598 predicted 1156
8 SASI_Mm01_00185599 predicted 1265
9 SASI_Mm01_00185600 predicted 1216
10 SASI_Mm02_00349055 predicted 347
11 SASI_Mm01_00185593 predicted 610
12 SASI_Mm01_00185594 predicted 403
13 SASI_Mm01_00185595 predicted 676
14 SASI_Mm01_00185601 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178645
VALIDATED
BLMH MISSION shRNA Bacterial Glycerol Stock
bleomycin hydrolase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178645.3-1737s21c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-901s21c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-160s21c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-951s21c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1738s1c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178645.1-902s1c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-952s1c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-161s1c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1018s1c1
Sequence:CCGGGCTGTATAACAACCAGCCCATCTCGAGATGGGCTGGTTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178645
VALIDATED
BLMH MISSION shRNA shRNA Plasmid DNA
bleomycin hydrolase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178645.3-1737s21c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-901s21c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-160s21c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-951s21c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1738s1c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178645.1-902s1c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-952s1c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-161s1c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1018s1c1
Sequence:CCGGGCTGTATAACAACCAGCCCATCTCGAGATGGGCTGGTTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178645
VALIDATED
BLMH MISSION shRNA Lentiviral Transduction Particles
bleomycin hydrolase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327639    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178645.3-1737s21c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-901s21c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-160s21c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178645.3-951s21c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1738s1c1
Sequence:CCGGGCTCAGGATCTCGTAGCATTTCTCGAGAAATGCTACGAGATCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178645.1-902s1c1
Sequence:CCGGCCGCTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-952s1c1
Sequence:CCGGCCAGCACAAGTACAATAAATTCTCGAGAATTTATTGTACTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-161s1c1
Sequence:CCGGGCTTTGATCCAGAAACTAAATCTCGAGATTTAGTTTCTGGATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178645.1-1018s1c1
Sequence:CCGGGCTGTATAACAACCAGCCCATCTCGAGATGGGCTGGTTGTTATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000386
VALIDATED
BLMH MISSION shRNA Bacterial Glycerol Stock
bleomycin hydrolase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-728s21c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1015s21c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-274s21c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-672s21c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1446s21c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-672s1c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-728s1c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1015s1c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1446s1c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-274s1c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000386
VALIDATED
BLMH MISSION shRNA shRNA Plasmid DNA
bleomycin hydrolase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-728s21c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1015s21c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-274s21c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-672s21c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1446s21c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-672s1c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-728s1c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1015s1c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1446s1c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-274s1c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000386
VALIDATED
BLMH MISSION shRNA Lentiviral Transduction Particles
bleomycin hydrolase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-728s21c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1015s21c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-274s21c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-672s21c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000386.2-1446s21c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-672s1c1
Sequence:CCGGCCAATGGGATATGCTTGTTAACTCGAGTTAACAAGCATATCCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-728s1c1
Sequence:CCGGGCTTCCCTGAATCTTATACAACTCGAGTTGTATAAGATTCAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1015s1c1
Sequence:CCGGCCACTCTTCAATATGGAAGATCTCGAGATCTTCCATATTGAAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000386.2-1446s1c1
Sequence:CCGGCCACAAAGGTTACCTGTGCATCTCGAGATGCACAGGTAACCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000386.2-274s1c1
Sequence:CCGGGCTCTGATACAGAAACTGAATCTCGAGATTCAGTTTCTGTATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks