EMAIL THIS PAGE TO A FRIEND

BLNK

B-cell linker

Synonyms: AGM4 BASH BLNK-S LY57 SLP-65 SLP65 bca
UniProtKB ID: Q8WV28, O75498, O75499, Q2MD49
Gene ID:
Human(29760) Summary: This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Mouse(17060) B cell linker
Rat(499356) B-cell linker
Zebrafish(405764) B-cell linker
chicken(395733) B-cell linker
dog(486814) B-cell linker
cow(510393) B-cell linker
Horse(100070841) B-cell linker
domestic cat(101086423) B-cell linker
sheep(101111241) B-cell linker
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2104918 Anti-BLNK antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, rat, guinea pig
western blot pricing
HPA038309 Anti-BLNK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA038310 Anti-BLNK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501341 Anti-BLNK antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB1410596 Anti-BLNK antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2500165 Anti-BLNK/SLP-65 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, canine, human, mouse, bovine, rat
ELISA, western blot pricing
B2560 Anti-phospho-B Cell Linker Protein (BLNK) (pSer84) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
SAB4504658 Anti-phospho-BLNK (pTyr84) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504021 Anti-phospho-BLNK (pTyr96) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301461 Anti-phospho-BLNK (pTyr96) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5300334 Monoclonal Anti-BLNK antibody produced in mouse clone 5G9, ascites fluid mouse, human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402572 Monoclonal Anti-BLNK antibody produced in mouse clone 1D7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008528 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008528 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008528 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114094 Rosetta Predictions human pricing
NM_013314 Rosetta Predictions human pricing
NM_001025767 Rosetta Predictions rat pricing
NM_008528 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326204 predicted 377
2 SASI_Hs02_00326205 predicted 1199
3 SASI_Hs02_00326206 predicted 1088
4 SASI_Hs02_00326207 predicted 1026
5 SASI_Hs02_00326208 predicted 1195
6 SASI_Hs02_00326209 predicted 294
7 SASI_Hs02_00326210 predicted 1179
8 SASI_Hs02_00326211 predicted 428
9 SASI_Hs02_00326212 predicted 410
10 SASI_Hs02_00326213 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196853 predicted 371
2 SASI_Hs02_00344602 predicted 1272
3 SASI_Hs01_00196854 predicted 1165
4 SASI_Hs01_00196856 predicted 1089
5 SASI_Hs01_00196860 predicted 1261
6 SASI_Hs02_00344603 predicted 297
7 SASI_Hs02_00344604 predicted 1241
8 SASI_Hs02_00344605 predicted 425
9 SASI_Hs02_00344606 predicted 411
10 SASI_Hs02_00344607 predicted 314
11 SASI_Hs01_00196851 predicted 1307
12 SASI_Hs01_00196852 predicted 1054
13 SASI_Hs01_00196855 predicted 969
14 SASI_Hs01_00196857 predicted 960
15 SASI_Hs01_00196858 predicted 1070
16 SASI_Hs01_00196859 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033102 predicted 1257
2 SASI_Rn01_00033103 predicted 451
3 SASI_Rn01_00033104 predicted 1264
4 SASI_Rn01_00033105 predicted 998
5 SASI_Rn01_00033106 predicted 200
6 SASI_Rn01_00033107 predicted 1253
7 SASI_Rn01_00033108 predicted 222
8 SASI_Rn01_00033110 predicted 1298
9 SASI_Rn02_00203445 predicted 610
10 SASI_Rn01_00033111 predicted 1412
11 SASI_Rn01_00033109 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119417 predicted 822
2 SASI_Mm01_00119418 predicted 1506
3 SASI_Mm01_00119419 predicted 1270
4 SASI_Mm02_00314112 predicted 533
5 SASI_Mm01_00119420 predicted 1795
6 SASI_Mm01_00119421 predicted 1457
7 SASI_Mm01_00119422 predicted 550
8 SASI_Mm01_00119423 predicted 560
9 SASI_Mm01_00119424 predicted 1629
10 SASI_Mm01_00119425 predicted 1562
11 SASI_Mm01_00119426 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013314
BLNK MISSION shRNA Bacterial Glycerol Stock
B-cell linker
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1365s1c1
Sequence:CCGGGCGATTTATTGAAGCAACAAACTCGAGTTTGTTGCTTCAATAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-712s1c1
Sequence:CCGGCCCGTGGAAGATAATGATGAACTCGAGTTCATCATTATCTTCCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-521s1c1
Sequence:CCGGGCGAGTATATAGACAATCGATCTCGAGATCGATTGTCTATATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1299s1c1
Sequence:CCGGCCATGATTCCAAACAACCATACTCGAGTATGGTTGTTTGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1090s1c1
Sequence:CCGGCCCATACCTCTGCCAAGATTTCTCGAGAAATCTTGGCAGAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-518s21c1
Sequence:CCGGTTCGCCAGAGGCGAGTATATACTCGAGTATATACTCGCCTCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-1309s21c1
Sequence:CCGGTGATTCCAAACAACCATATACCTCGAGGTATATGGTTGTTTGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013314
BLNK MISSION shRNA shRNA Plasmid DNA
B-cell linker
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1365s1c1
Sequence:CCGGGCGATTTATTGAAGCAACAAACTCGAGTTTGTTGCTTCAATAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-712s1c1
Sequence:CCGGCCCGTGGAAGATAATGATGAACTCGAGTTCATCATTATCTTCCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-521s1c1
Sequence:CCGGGCGAGTATATAGACAATCGATCTCGAGATCGATTGTCTATATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1299s1c1
Sequence:CCGGCCATGATTCCAAACAACCATACTCGAGTATGGTTGTTTGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1090s1c1
Sequence:CCGGCCCATACCTCTGCCAAGATTTCTCGAGAAATCTTGGCAGAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-518s21c1
Sequence:CCGGTTCGCCAGAGGCGAGTATATACTCGAGTATATACTCGCCTCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-1309s21c1
Sequence:CCGGTGATTCCAAACAACCATATACCTCGAGGTATATGGTTGTTTGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013314
BLNK MISSION shRNA Lentiviral Transduction Particles
B-cell linker
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1365s1c1
Sequence:CCGGGCGATTTATTGAAGCAACAAACTCGAGTTTGTTGCTTCAATAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-712s1c1
Sequence:CCGGCCCGTGGAAGATAATGATGAACTCGAGTTCATCATTATCTTCCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-521s1c1
Sequence:CCGGGCGAGTATATAGACAATCGATCTCGAGATCGATTGTCTATATACTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1299s1c1
Sequence:CCGGCCATGATTCCAAACAACCATACTCGAGTATGGTTGTTTGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013314.2-1090s1c1
Sequence:CCGGCCCATACCTCTGCCAAGATTTCTCGAGAAATCTTGGCAGAGGTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-518s21c1
Sequence:CCGGTTCGCCAGAGGCGAGTATATACTCGAGTATATACTCGCCTCTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013314.3-1309s21c1
Sequence:CCGGTGATTCCAAACAACCATATACCTCGAGGTATATGGTTGTTTGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008528
BLNK MISSION shRNA Bacterial Glycerol Stock
B-cell linker
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1953s1c1
Sequence:CCGGCACTGAGGCTTCGTGAATGAACTCGAGTTCATTCACGAAGCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1960s1c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1691s1c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1279s1c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-992s21c1
Sequence:CCGGTTGAGGATGAGGCTGATTATGCTCGAGCATAATCAGCCTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-619s21c1
Sequence:CCGGCCTCGAAGGGACTACGCATTACTCGAGTAATGCGTAGTCCCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008528.4-1960s21c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1691s21c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1279s21c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008528
BLNK MISSION shRNA shRNA Plasmid DNA
B-cell linker
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1953s1c1
Sequence:CCGGCACTGAGGCTTCGTGAATGAACTCGAGTTCATTCACGAAGCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1960s1c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1691s1c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1279s1c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-992s21c1
Sequence:CCGGTTGAGGATGAGGCTGATTATGCTCGAGCATAATCAGCCTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-619s21c1
Sequence:CCGGCCTCGAAGGGACTACGCATTACTCGAGTAATGCGTAGTCCCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008528.4-1960s21c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1691s21c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1279s21c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008528
BLNK MISSION shRNA Lentiviral Transduction Particles
B-cell linker
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1953s1c1
Sequence:CCGGCACTGAGGCTTCGTGAATGAACTCGAGTTCATTCACGAAGCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008528.3-1960s1c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1691s1c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008528.3-1279s1c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-992s21c1
Sequence:CCGGTTGAGGATGAGGCTGATTATGCTCGAGCATAATCAGCCTCATCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-619s21c1
Sequence:CCGGCCTCGAAGGGACTACGCATTACTCGAGTAATGCGTAGTCCCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008528.4-1960s21c1
Sequence:CCGGGCTTCGTGAATGAATGAATCTCTCGAGAGATTCATTCATTCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1691s21c1
Sequence:CCGGCCAAACAGTATGCTTTGGGAACTCGAGTTCCCAAAGCATACTGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008528.4-1279s21c1
Sequence:CCGGGCATCAAATGTTTGTGAAGAACTCGAGTTCTTCACAAACATTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks