EMAIL THIS PAGE TO A FRIEND

BLOC1S1

biogenesis of lysosomal organelles complex-1, subunit 1

35 Gene Product Result for
Synonyms: BLOS1 GCN5L1 MICoA RT14
UniProtKB ID: P78537, A1L4Q9, Q6NZ45
Gene ID:
Human(2647) Summary: BLOC1S1 is a component of the ubiquitously expressed BLOC1 multisubunit protein complex. BLOC1 is required for normal biogenesis of specialized organelles of the endosomal-lysosomal system, such as melanosomes and platelet dense granules (Starcevic and Dell'Angelica, 2004 [PubMed 15102850]
Mouse(14533) biogenesis of lysosome-related organelles complex-1, subunit 1
Rat(288785) biogenesis of lysosomal organelles complex-1, subunit 1
dog(481098) biogenesis of lysosomal organelles complex-1, subunit 1
cow(615149) biogenesis of lysosomal organelles complex-1, subunit 1
domestic cat(101090196) biogenesis of lysosomal organelles complex-1, subunit 1
sheep(101105150) biogenesis of lysosomal organelles complex-1, subunit 1
domestic guinea pig(100723295) biogenesis of lysosomal organelles complex-1, subunit 1
naked mole-rat(101700725) biogenesis of lysosomal organelles complex-1, subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001487 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001487 Rosetta Predictions human pricing
NM_001105941 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331969 predicted 197
2 SASI_Hs02_00331970 predicted 324
3 SASI_Hs01_00189658 predicted 266
4 SASI_Hs01_00189659 predicted 328
5 SASI_Hs01_00189660 predicted 236
6 SASI_Hs01_00189662 predicted 199
7 SASI_Hs01_00189663 predicted 314
8 SASI_Hs01_00189664 predicted 299
9 SASI_Hs01_00189666 predicted 327
10 SASI_Hs01_00189667 predicted 200
11 SASI_Hs01_00189661 predicted 243
12 SASI_Hs01_00189665 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214052 predicted 311
2 SASI_Rn02_00214053 predicted 318
3 SASI_Rn02_00214054 predicted 253
4 SASI_Rn02_00214055 predicted 312
5 SASI_Rn02_00214056 predicted 322
6 SASI_Rn02_00214057 predicted 312
7 SASI_Rn02_00214058 predicted 294
8 SASI_Rn02_00214059 predicted 320
9 SASI_Rn02_00214060 predicted 427
10 SASI_Rn02_00214061 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015740
VALIDATED
BLOC1S1 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-320s21c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-152s21c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015740.3-260s21c1
Sequence:CCGGCCATGAGGTGAAGACTCTACACTCGAGTGTAGAGTCTTCACCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-233s21c1
Sequence:CCGGGGCCTACATGAACCAGAGAAACTCGAGTTTCTCTGGTTCATGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-335s21c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-334s1c1
Sequence:CCGGGAGAACTTCAACCAGGCACTTCTCGAGAAGTGCCTGGTTGAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-318s1c1
Sequence:CCGGGTGGATTGGAATGGTGGAGAACTCGAGTTCTCCACCATTCCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-336s1c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-153s1c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-321s1c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015740
VALIDATED
BLOC1S1 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-320s21c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-152s21c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015740.3-260s21c1
Sequence:CCGGCCATGAGGTGAAGACTCTACACTCGAGTGTAGAGTCTTCACCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-233s21c1
Sequence:CCGGGGCCTACATGAACCAGAGAAACTCGAGTTTCTCTGGTTCATGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-335s21c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-334s1c1
Sequence:CCGGGAGAACTTCAACCAGGCACTTCTCGAGAAGTGCCTGGTTGAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-318s1c1
Sequence:CCGGGTGGATTGGAATGGTGGAGAACTCGAGTTCTCCACCATTCCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-336s1c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-153s1c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-321s1c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015740
VALIDATED
BLOC1S1 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-320s21c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-152s21c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015740.3-260s21c1
Sequence:CCGGCCATGAGGTGAAGACTCTACACTCGAGTGTAGAGTCTTCACCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-233s21c1
Sequence:CCGGGGCCTACATGAACCAGAGAAACTCGAGTTTCTCTGGTTCATGTAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015740.3-335s21c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-334s1c1
Sequence:CCGGGAGAACTTCAACCAGGCACTTCTCGAGAAGTGCCTGGTTGAAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-318s1c1
Sequence:CCGGGTGGATTGGAATGGTGGAGAACTCGAGTTCTCCACCATTCCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-336s1c1
Sequence:CCGGGAACTTCAACCAGGCACTTAACTCGAGTTAAGTGCCTGGTTGAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015740.2-153s1c1
Sequence:CCGGGAAGAGGAGGAGAGAAGCTATCTCGAGATAGCTTCTCTCCTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015740.2-321s1c1
Sequence:CCGGGATTGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001487
VALIDATED
BLOC1S1 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-331s21c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-302s21c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-133s21c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001487.1-207s1c1
Sequence:CCGGGCTTTGGTGGATCACCTCAATCTCGAGATTGAGGTGATCCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-329s1c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-402s1c1
Sequence:CCGGGAGCTGGACATGCGCACCATTCTCGAGAATGGTGCGCATGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-300s1c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-131s1c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001487
VALIDATED
BLOC1S1 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-331s21c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-302s21c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-133s21c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001487.1-207s1c1
Sequence:CCGGGCTTTGGTGGATCACCTCAATCTCGAGATTGAGGTGATCCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-329s1c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-402s1c1
Sequence:CCGGGAGCTGGACATGCGCACCATTCTCGAGAATGGTGCGCATGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-300s1c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-131s1c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001487
VALIDATED
BLOC1S1 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-331s21c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-302s21c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001487.2-133s21c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001487.1-207s1c1
Sequence:CCGGGCTTTGGTGGATCACCTCAATCTCGAGATTGAGGTGATCCACCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-329s1c1
Sequence:CCGGGATCGGAATGGTGGAGAACTTCTCGAGAAGTTCTCCACCATTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-402s1c1
Sequence:CCGGGAGCTGGACATGCGCACCATTCTCGAGAATGGTGCGCATGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-300s1c1
Sequence:CCGGGCCCAATTTGCCAAGCAGACACTCGAGTGTCTGCTTGGCAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001487.1-131s1c1
Sequence:CCGGCAAGCAGAATGAACGCAAGGACTCGAGTCCTTGCGTTCATTCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks