EMAIL THIS PAGE TO A FRIEND

BLOC1S2

biogenesis of lysosomal organelles complex-1, subunit 2

195 Gene Product Result for
Synonyms: BLOS2 CEAP CEAP11 RP11-316M21.4
UniProtKB ID: Q6QNY1, B4DQV2, Q5W040, Q8WUI8
Gene ID:
Human(282991) Summary: This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(73689) biogenesis of lysosome-related organelles complex-1, subunit 2
Rat(293938) biogenesis of lysosomal organelles complex-1, subunit 2
chicken(423768) biogenesis of lysosomal organelles complex-1, subunit 2
domestic cat(101091152) biogenesis of lysosomal organelles complex-1, subunit 2
dog(612865) biogenesis of lysosomal organelles complex-1, subunit 2
domestic guinea pig(100727083) biogenesis of lysosomal organelles complex-1, subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001342 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088661 MISSION® esiRNA esiRNA human BLOC1S2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001342 Rosetta Predictions human pricing
NM_173809 Rosetta Predictions human pricing
NM_001037349 Rosetta Predictions rat pricing
XM_001002813 Rosetta Predictions mouse pricing
XM_193940 Rosetta Predictions mouse pricing
XM_619591 Rosetta Predictions mouse pricing
XM_894551 Rosetta Predictions mouse pricing
XM_901653 Rosetta Predictions mouse pricing
XM_901657 Rosetta Predictions mouse pricing
XM_901658 Rosetta Predictions mouse pricing
XM_925258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227619 predicted 983
2 SASI_Hs01_00227620 predicted 839
3 SASI_Hs01_00227621 predicted 931
4 SASI_Hs01_00227622 predicted 917
5 SASI_Hs01_00227623 predicted 758
6 SASI_Hs01_00227624 predicted 837
7 SASI_Hs01_00227625 predicted 814
8 SASI_Hs02_00303722 predicted 308
9 SASI_Hs01_00227626 predicted 358
10 SASI_Hs01_00227627 predicted 265
11 SASI_Hs01_00227628 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082438 predicted 912
2 SASI_Hs01_00082439 predicted 777
3 SASI_Hs01_00082440 predicted 863
4 SASI_Hs01_00082441 predicted 855
5 SASI_Hs01_00082442 predicted 695
6 SASI_Hs01_00082443 predicted 771
7 SASI_Hs01_00082444 predicted 744
8 SASI_Hs01_00082445 predicted 289
9 SASI_Hs01_00082446 predicted 199
10 SASI_Hs01_00082447 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042468 predicted 291
2 SASI_Rn01_00042469 predicted 362
3 SASI_Rn01_00042470 predicted 442
4 SASI_Rn01_00042471 predicted 497
5 SASI_Rn01_00042472 predicted 445
6 SASI_Rn01_00042473 predicted 516
7 SASI_Rn01_00042474 predicted 562
8 SASI_Rn01_00042475 predicted 419
9 SASI_Rn01_00042476 predicted 386
10 SASI_Rn01_00042477 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249676 predicted 221
2 SASI_Mm01_00249677 predicted 225
3 SASI_Mm01_00249678 predicted 221
4 SASI_Mm01_00249679 predicted 203
5 SASI_Mm01_00249680 predicted 219
6 SASI_Mm01_00249681 predicted 207
7 SASI_Mm01_00249682 predicted 243
8 SASI_Mm01_00249683 predicted 210
9 SASI_Mm01_00249684 predicted 239
10 SASI_Mm01_00249685 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_193940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257616 predicted 399
2 SASI_Mm01_00257617 predicted 391
3 SASI_Mm01_00257618 predicted 335
4 SASI_Mm01_00257619 predicted 469
5 SASI_Mm02_00425460 predicted 270
6 SASI_Mm01_00257622 predicted 468
7 SASI_Mm01_00257624 predicted 483
8 SASI_Mm02_00425461 predicted 313
9 SASI_Mm01_00257625 predicted 445
10 SASI_Mm02_00425462 predicted 242
11 SASI_Mm01_00257620 predicted 257
12 SASI_Mm01_00257621 predicted 388
13 SASI_Mm01_00257623 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427455 predicted 273
2 SASI_Mm02_00427456 predicted 272
3 SASI_Mm02_00427457 predicted 350
4 SASI_Mm02_00427458 predicted 358
5 SASI_Mm02_00427459 predicted 341
6 SASI_Mm02_00427460 predicted 370
7 SASI_Mm02_00427461 predicted 326
8 SASI_Mm02_00427462 predicted 326
9 SASI_Mm02_00427463 predicted 358
10 SASI_Mm02_00427464 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236075 predicted 405
2 SASI_Mm01_00236076 predicted 393
3 SASI_Mm01_00236077 predicted 342
4 SASI_Mm01_00236078 predicted 339
5 SASI_Mm01_00236079 predicted 213
6 SASI_Mm01_00236080 predicted 402
7 SASI_Mm01_00236081 predicted 298
8 SASI_Mm01_00236082 predicted 484
9 SASI_Mm01_00236083 predicted 246
10 SASI_Mm01_00236084 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238502 predicted 609
2 SASI_Mm01_00238503 predicted 601
3 SASI_Mm01_00238504 predicted 558
4 SASI_Mm01_00238505 predicted 613
5 SASI_Mm01_00238506 predicted 608
6 SASI_Mm01_00238507 predicted 607
7 SASI_Mm01_00238508 predicted 602
8 SASI_Mm01_00238509 predicted 563
9 SASI_Mm01_00238510 predicted 588
10 SASI_Mm01_00238511 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271280 predicted 515
2 SASI_Mm01_00271281 predicted 296
3 SASI_Mm01_00271282 predicted 266
4 SASI_Mm01_00271283 predicted 276
5 SASI_Mm01_00271284 predicted 295
6 SASI_Mm01_00271285 predicted 286
7 SASI_Mm01_00271286 predicted 299
8 SASI_Mm01_00271287 predicted 248
9 SASI_Mm01_00271288 predicted 335
10 SASI_Mm01_00271289 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253720 predicted 354
2 SASI_Mm01_00253721 predicted 351
3 SASI_Mm01_00253722 predicted 342
4 SASI_Mm01_00253723 predicted 394
5 SASI_Mm01_00253724 predicted 367
6 SASI_Mm01_00253726 predicted 331
7 SASI_Mm01_00253727 predicted 325
8 SASI_Mm01_00253728 predicted 358
9 SASI_Mm01_00253729 predicted 456
10 SASI_Mm02_00430189 predicted 454
11 SASI_Mm01_00253725 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444522 predicted 397
2 SASI_Mm02_00444523 predicted 331
3 SASI_Mm02_00444524 predicted 471
4 SASI_Mm02_00444525 predicted 450
5 SASI_Mm02_00444526 predicted 268
6 SASI_Mm02_00444527 predicted 469
7 SASI_Mm02_00444528 predicted 486
8 SASI_Mm02_00444529 predicted 313
9 SASI_Mm02_00444530 predicted 441
10 SASI_Mm02_00444531 predicted 200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173809
VALIDATED
BLOC1S2 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-245s1c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173809.1-232s1c1
Sequence:CCGGCTTATCTGGATCAGATCAATGCTCGAGCATTGATCTGATCCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-131s1c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-240s1c1
Sequence:CCGGGATCAGATCAATGTCATTGAACTCGAGTTCAATGACATTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173809.1-293s1c1
Sequence:CCGGCAAGTTGGATGCATATTCAAACTCGAGTTTGAATATGCATCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-285s1c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-209s1c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-252s1c1
Sequence:CCGGGTCATTGAAGAGCAGGTAGCACTCGAGTGCTACCTGCTCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-227s1c1
Sequence:CCGGGCAGCCTTATCTGGATCAGATCTCGAGATCTGATCCAGATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173809
VALIDATED
BLOC1S2 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-245s1c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173809.1-232s1c1
Sequence:CCGGCTTATCTGGATCAGATCAATGCTCGAGCATTGATCTGATCCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-131s1c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-240s1c1
Sequence:CCGGGATCAGATCAATGTCATTGAACTCGAGTTCAATGACATTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173809.1-293s1c1
Sequence:CCGGCAAGTTGGATGCATATTCAAACTCGAGTTTGAATATGCATCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-285s1c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-209s1c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-252s1c1
Sequence:CCGGGTCATTGAAGAGCAGGTAGCACTCGAGTGCTACCTGCTCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-227s1c1
Sequence:CCGGGCAGCCTTATCTGGATCAGATCTCGAGATCTGATCCAGATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173809
VALIDATED
BLOC1S2 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-245s1c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173809.1-232s1c1
Sequence:CCGGCTTATCTGGATCAGATCAATGCTCGAGCATTGATCTGATCCAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-131s1c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-240s1c1
Sequence:CCGGGATCAGATCAATGTCATTGAACTCGAGTTCAATGACATTGATCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173809.1-293s1c1
Sequence:CCGGCAAGTTGGATGCATATTCAAACTCGAGTTTGAATATGCATCCAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-285s1c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_173809.1-209s1c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-252s1c1
Sequence:CCGGGTCATTGAAGAGCAGGTAGCACTCGAGTGCTACCTGCTCTTCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_173809.1-227s1c1
Sequence:CCGGGCAGCCTTATCTGGATCAGATCTCGAGATCTGATCCAGATAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028607
VALIDATED
BLOC1S2 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-455s21c1
Sequence:CCGGAGCGATGAGAATCGTGTTCATCTCGAGATGAACACGATTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-478s21c1
Sequence:CCGGGGCTCAAGTGTTTGTTAATATCTCGAGATATTAACAAACACTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-662s21c1
Sequence:CCGGTGGGACTCCTCACCGTTTACTCTCGAGAGTAAACGGTGAGGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-571s21c1
Sequence:CCGGTAAGCCCAAGGCCACGCAATACTCGAGTATTGCGTGGCCTTGGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028607.1-684s21c1
Sequence:CCGGGAATGCTTCATCATCCATCTACTCGAGTAGATGGATGATGAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028607
VALIDATED
BLOC1S2 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-455s21c1
Sequence:CCGGAGCGATGAGAATCGTGTTCATCTCGAGATGAACACGATTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-478s21c1
Sequence:CCGGGGCTCAAGTGTTTGTTAATATCTCGAGATATTAACAAACACTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-662s21c1
Sequence:CCGGTGGGACTCCTCACCGTTTACTCTCGAGAGTAAACGGTGAGGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-571s21c1
Sequence:CCGGTAAGCCCAAGGCCACGCAATACTCGAGTATTGCGTGGCCTTGGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028607.1-684s21c1
Sequence:CCGGGAATGCTTCATCATCCATCTACTCGAGTAGATGGATGATGAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028607
VALIDATED
BLOC1S2 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-455s21c1
Sequence:CCGGAGCGATGAGAATCGTGTTCATCTCGAGATGAACACGATTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342065    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-478s21c1
Sequence:CCGGGGCTCAAGTGTTTGTTAATATCTCGAGATATTAACAAACACTTGAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-662s21c1
Sequence:CCGGTGGGACTCCTCACCGTTTACTCTCGAGAGTAAACGGTGAGGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028607.1-571s21c1
Sequence:CCGGTAAGCCCAAGGCCACGCAATACTCGAGTATTGCGTGGCCTTGGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028607.1-684s21c1
Sequence:CCGGGAATGCTTCATCATCCATCTACTCGAGTAGATGGATGATGAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001342
BLOC1S2 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000343488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-374s21c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-450s21c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-296s21c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-410s21c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001342
BLOC1S2 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000343488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-374s21c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-450s21c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-296s21c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-410s21c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001342
BLOC1S2 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000343488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-374s21c1
Sequence:CCGGCCAGAAATATGCTGGACTGCACTCGAGTGCAGTCCAGCATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-450s21c1
Sequence:CCGGGCAGCTTACAAGTTGGATGCACTCGAGTGCATCCAACTTGTAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-296s21c1
Sequence:CCGGGAATAAACTCACCAGCTTGAACTCGAGTTCAAGCTGGTGAGTTTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001342.1-410s21c1
Sequence:CCGGGATCAATGTCATTGAAGAGCACTCGAGTGCTCTTCAATGACATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks