EMAIL THIS PAGE TO A FRIEND

BLOC1S3

biogenesis of lysosomal organelles complex-1, subunit 3

107 Gene Product Result for
Synonyms: BLOS3 HPS8 RP
UniProtKB ID: Q6QNY0, B2RXB8
Gene ID:
Human(388552) Summary: This gene encodes a protein that is a component of the BLOC1 multi-subunit protein complex. This complex is necessary for the biogenesis of specialized organelles of the endosomal-lysosomal system, including platelet dense granules and melanosomes. Mutations in this gene cause Hermansky-Pudlak syndrome 8, a disease characterized by lysosomal storage defects, bleeding due to platelet storage pool deficiency, and oculocutaneous albinism. [provided by RefSeq, Jul 2008]
Mouse(232946) biogenesis of lysosome-related organelles complex-1, subunit 3
Rat(680476) biogenesis of lysosomal organelles complex-1, subunit 3
naked mole-rat(101723139) biogenesis of lysosomal organelles complex-1, subunit 3
domestic guinea pig(100733013) biogenesis of lysosomal organelles complex-1, subunit 3
sheep(101112341) biogenesis of lysosomal organelles complex-1, subunit 3
Zebrafish(553529) biogenesis of lysosomal organelles complex-1, subunit 3
cow(538539) biogenesis of lysosomal organelles complex-1, subunit 3
dog(612307) biogenesis of lysosomal organelles complex-1, subunit 3
chicken(426500) biogenesis of lysosomal organelles complex-1, subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212550 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212550 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212550 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212550 Rosetta Predictions human pricing
XM_001058094 Rosetta Predictions rat pricing
NM_177692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374219 predicted 759
2 SASI_Hs02_00374220 predicted 764
3 SASI_Hs02_00374221 predicted 701
4 SASI_Hs02_00374222 predicted 989
5 SASI_Hs02_00374223 predicted 974
6 SASI_Hs02_00374224 predicted 1853
7 SASI_Hs02_00374225 predicted 2284
8 SASI_Hs02_00374226 predicted 2507
9 SASI_Hs02_00374227 predicted 1966
10 SASI_Hs02_00374228 predicted 2297
11 SASI_Hs01_00092587 predicted 410
12 SASI_Hs01_00092588 predicted 378
13 SASI_Hs01_00092589 predicted 507
14 SASI_Hs01_00092590 predicted 65
15 SASI_Hs01_00092591 predicted 534
16 SASI_Hs01_00092592 predicted 249
17 SASI_Hs01_00092593 predicted 232
18 SASI_Hs01_00092594 predicted 385
19 SASI_Hs01_00092595 predicted 508
20 SASI_Hs01_00092596 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288564 predicted 890
2 SASI_Rn02_00288565 predicted 817
3 SASI_Rn02_00288566 predicted 924
4 SASI_Rn02_00288567 predicted 734
5 SASI_Rn02_00288568 predicted 861
6 SASI_Rn02_00288569 predicted 749
7 SASI_Rn02_00288570 predicted 851
8 SASI_Rn02_00288571 predicted 1297
9 SASI_Rn02_00288572 predicted 883
10 SASI_Rn02_00288573 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348026 predicted 993
2 SASI_Mm02_00348027 predicted 812
3 SASI_Mm02_00348028 predicted 753
4 SASI_Mm02_00348029 predicted 1069
5 SASI_Mm02_00348030 predicted 1001
6 SASI_Mm02_00348031 predicted 955
7 SASI_Mm02_00348032 predicted 761
8 SASI_Mm02_00348033 predicted 721
9 SASI_Mm02_00348034 predicted 942
10 SASI_Mm02_00348035 predicted 995
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212550
VALIDATED
BLOC1S3 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1998s21c1
Sequence:CCGGTACTGTCTCCATCCTACTTACCTCGAGGTAAGTAGGATGGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-845s21c1
Sequence:CCGGCCCTTGGATAATGCTTTATATCTCGAGATATAAAGCATTATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-719s21c1
Sequence:CCGGTCCCAACCTGACTGCAATTTGCTCGAGCAAATTGCAGTCAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1201s21c1
Sequence:CCGGGTCCAGCTGCCCGGTTAATTTCTCGAGAAATTAACCGGGCAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-2342s21c1
Sequence:CCGGTTGGCTCCTGGATGCTATAAACTCGAGTTTATAGCATCCAGGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212550
VALIDATED
BLOC1S3 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1998s21c1
Sequence:CCGGTACTGTCTCCATCCTACTTACCTCGAGGTAAGTAGGATGGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-845s21c1
Sequence:CCGGCCCTTGGATAATGCTTTATATCTCGAGATATAAAGCATTATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-719s21c1
Sequence:CCGGTCCCAACCTGACTGCAATTTGCTCGAGCAAATTGCAGTCAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1201s21c1
Sequence:CCGGGTCCAGCTGCCCGGTTAATTTCTCGAGAAATTAACCGGGCAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-2342s21c1
Sequence:CCGGTTGGCTCCTGGATGCTATAAACTCGAGTTTATAGCATCCAGGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212550
VALIDATED
BLOC1S3 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1998s21c1
Sequence:CCGGTACTGTCTCCATCCTACTTACCTCGAGGTAAGTAGGATGGAGACAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-845s21c1
Sequence:CCGGCCCTTGGATAATGCTTTATATCTCGAGATATAAAGCATTATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245955    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-719s21c1
Sequence:CCGGTCCCAACCTGACTGCAATTTGCTCGAGCAAATTGCAGTCAGGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212550.3-1201s21c1
Sequence:CCGGGTCCAGCTGCCCGGTTAATTTCTCGAGAAATTAACCGGGCAGCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_212550.3-2342s21c1
Sequence:CCGGTTGGCTCCTGGATGCTATAAACTCGAGTTTATAGCATCCAGGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177692
BLOC1S3 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-1137s1c1
Sequence:CCGGGAGACATGACACCACAAATACCTCGAGGTATTTGTGGTGTCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-846s1c1
Sequence:CCGGCCTATCCATTCTGGTCCTGTTCTCGAGAACAGGACCAGAATGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-771s1c1
Sequence:CCGGCGCATCTTCTTTGATATTCTTCTCGAGAAGAATATCAAAGAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-861s1c1
Sequence:CCGGCCTGTTTCCTAAATTCAGCTTCTCGAGAAGCTGAATTTAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-768s1c1
Sequence:CCGGCCTCGCATCTTCTTTGATATTCTCGAGAATATCAAAGAAGATGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-1616s1c1
Sequence:CCGGCGGTCAAACTAGAACATTCTTCTCGAGAAGAATGTTCTAGTTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-922s1c1
Sequence:CCGGGCCTTTCTGAATTTAGGCTTTCTCGAGAAAGCCTAAATTCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177692
BLOC1S3 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-1137s1c1
Sequence:CCGGGAGACATGACACCACAAATACCTCGAGGTATTTGTGGTGTCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-846s1c1
Sequence:CCGGCCTATCCATTCTGGTCCTGTTCTCGAGAACAGGACCAGAATGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-771s1c1
Sequence:CCGGCGCATCTTCTTTGATATTCTTCTCGAGAAGAATATCAAAGAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-861s1c1
Sequence:CCGGCCTGTTTCCTAAATTCAGCTTCTCGAGAAGCTGAATTTAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-768s1c1
Sequence:CCGGCCTCGCATCTTCTTTGATATTCTCGAGAATATCAAAGAAGATGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-1616s1c1
Sequence:CCGGCGGTCAAACTAGAACATTCTTCTCGAGAAGAATGTTCTAGTTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-922s1c1
Sequence:CCGGGCCTTTCTGAATTTAGGCTTTCTCGAGAAAGCCTAAATTCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177692
BLOC1S3 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-1137s1c1
Sequence:CCGGGAGACATGACACCACAAATACCTCGAGGTATTTGTGGTGTCATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201989    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177692.3-846s1c1
Sequence:CCGGCCTATCCATTCTGGTCCTGTTCTCGAGAACAGGACCAGAATGGATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-771s1c1
Sequence:CCGGCGCATCTTCTTTGATATTCTTCTCGAGAAGAATATCAAAGAAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-861s1c1
Sequence:CCGGCCTGTTTCCTAAATTCAGCTTCTCGAGAAGCTGAATTTAGGAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-768s1c1
Sequence:CCGGCCTCGCATCTTCTTTGATATTCTCGAGAATATCAAAGAAGATGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201066    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-1616s1c1
Sequence:CCGGCGGTCAAACTAGAACATTCTTCTCGAGAAGAATGTTCTAGTTTGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177692.3-922s1c1
Sequence:CCGGGCCTTTCTGAATTTAGGCTTTCTCGAGAAAGCCTAAATTCAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks