EMAIL THIS PAGE TO A FRIEND

BLOC1S4

biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino

72 Gene Product Result for
Synonyms: BCAS4L BLOS4 CNO
UniProtKB ID: Q9NUP1, Q6NVY6, Q96G84
Gene ID:
Human(55330) Summary: This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and is a model for Hermansky-Pudlak syndrome. The encoded protein may play a role in intracellular vesicular trafficking. [provided by RefSeq, Jul 2008]
Mouse(117197) biogenesis of organelles complex-1, subunit 4, cappuccino
Rat(364183) biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Zebrafish(445081) biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
domestic cat(101091019) biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
domestic guinea pig(100715272) biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
naked mole-rat(101713931) biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136441 MISSION® esiRNA esiRNA human CNO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018366 Rosetta Predictions human pricing
NM_001100766 Rosetta Predictions rat pricing
NM_133724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068749 predicted 691
2 SASI_Hs01_00068750 predicted 625
3 SASI_Hs01_00068751 predicted 614
4 SASI_Hs02_00351836 predicted 686
5 SASI_Hs01_00068752 predicted 708
6 SASI_Hs01_00068753 predicted 601
7 SASI_Hs01_00068754 predicted 628
8 SASI_Hs01_00068755 predicted 598
9 SASI_Hs01_00068756 predicted 626
10 SASI_Hs01_00068758 predicted 624
11 SASI_Hs01_00068757 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210508 predicted 409
2 SASI_Rn02_00210509 predicted 1025
3 SASI_Rn02_00210510 predicted 924
4 SASI_Rn02_00210511 predicted 982
5 SASI_Rn02_00210512 predicted 1073
6 SASI_Rn02_00210513 predicted 711
7 SASI_Rn02_00210514 predicted 877
8 SASI_Rn02_00210515 predicted 792
9 SASI_Rn02_00210516 predicted 914
10 SASI_Rn02_00210517 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338703 predicted 757
2 SASI_Mm01_00085165 predicted 765
3 SASI_Mm01_00085166 predicted 839
4 SASI_Mm01_00085167 predicted 823
5 SASI_Mm01_00085168 predicted 894
6 SASI_Mm01_00085169 predicted 803
7 SASI_Mm01_00085170 predicted 1014
8 SASI_Mm01_00085171 predicted 849
9 SASI_Mm01_00085173 predicted 908
10 SASI_Mm02_00338704 predicted 644
11 SASI_Mm01_00085164 predicted 1122
12 SASI_Mm01_00085172 predicted 1056
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018366
BLOC1S4 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-814s1c1
Sequence:CCGGCAAATCCTGCTTATGGACATACTCGAGTATGTCCATAAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1333s1c1
Sequence:CCGGGACCAAAGGAAATGGTACAATCTCGAGATTGTACCATTTCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-796s1c1
Sequence:CCGGCCAGTATGAAGTGAATTGCAACTCGAGTTGCAATTCACTTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-716s1c1
Sequence:CCGGCTTCCCTTGTTGCAGTGAAAGCTCGAGCTTTCACTGCAACAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-707s1c1
Sequence:CCGGCGAAGACTACTTCCCTTGTTGCTCGAGCAACAAGGGAAGTAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1322s1c1
Sequence:CCGGCGTGGATTGTAGACCAAAGGACTCGAGTCCTTTGGTCTACAATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1312s1c1
Sequence:CCGGCCTCCTATAGCGTGGATTGTACTCGAGTACAATCCACGCTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-711s1c1
Sequence:CCGGGACTACTTCCCTTGTTGCAGTCTCGAGACTGCAACAAGGGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018366.2-706s1c1
Sequence:CCGGCCGAAGACTACTTCCCTTGTTCTCGAGAACAAGGGAAGTAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1057s1c1
Sequence:CCGGCCTGTGTCTTCCAGCTCTAATCTCGAGATTAGAGCTGGAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1335s1c1
Sequence:CCGGCCAAAGGAAATGGTACAATTTCTCGAGAAATTGTACCATTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018366
BLOC1S4 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-814s1c1
Sequence:CCGGCAAATCCTGCTTATGGACATACTCGAGTATGTCCATAAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1333s1c1
Sequence:CCGGGACCAAAGGAAATGGTACAATCTCGAGATTGTACCATTTCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-796s1c1
Sequence:CCGGCCAGTATGAAGTGAATTGCAACTCGAGTTGCAATTCACTTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-716s1c1
Sequence:CCGGCTTCCCTTGTTGCAGTGAAAGCTCGAGCTTTCACTGCAACAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-707s1c1
Sequence:CCGGCGAAGACTACTTCCCTTGTTGCTCGAGCAACAAGGGAAGTAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1322s1c1
Sequence:CCGGCGTGGATTGTAGACCAAAGGACTCGAGTCCTTTGGTCTACAATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1312s1c1
Sequence:CCGGCCTCCTATAGCGTGGATTGTACTCGAGTACAATCCACGCTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-711s1c1
Sequence:CCGGGACTACTTCCCTTGTTGCAGTCTCGAGACTGCAACAAGGGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018366.2-706s1c1
Sequence:CCGGCCGAAGACTACTTCCCTTGTTCTCGAGAACAAGGGAAGTAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1057s1c1
Sequence:CCGGCCTGTGTCTTCCAGCTCTAATCTCGAGATTAGAGCTGGAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1335s1c1
Sequence:CCGGCCAAAGGAAATGGTACAATTTCTCGAGAAATTGTACCATTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018366
BLOC1S4 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145548    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-814s1c1
Sequence:CCGGCAAATCCTGCTTATGGACATACTCGAGTATGTCCATAAGCAGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145412    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1333s1c1
Sequence:CCGGGACCAAAGGAAATGGTACAATCTCGAGATTGTACCATTTCCTTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-796s1c1
Sequence:CCGGCCAGTATGAAGTGAATTGCAACTCGAGTTGCAATTCACTTCATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-716s1c1
Sequence:CCGGCTTCCCTTGTTGCAGTGAAAGCTCGAGCTTTCACTGCAACAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-707s1c1
Sequence:CCGGCGAAGACTACTTCCCTTGTTGCTCGAGCAACAAGGGAAGTAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1322s1c1
Sequence:CCGGCGTGGATTGTAGACCAAAGGACTCGAGTCCTTTGGTCTACAATCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139076    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1312s1c1
Sequence:CCGGCCTCCTATAGCGTGGATTGTACTCGAGTACAATCCACGCTATAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018366.2-711s1c1
Sequence:CCGGGACTACTTCCCTTGTTGCAGTCTCGAGACTGCAACAAGGGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018366.2-706s1c1
Sequence:CCGGCCGAAGACTACTTCCCTTGTTCTCGAGAACAAGGGAAGTAGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018366.2-1057s1c1
Sequence:CCGGCCTGTGTCTTCCAGCTCTAATCTCGAGATTAGAGCTGGAAGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018366.2-1335s1c1
Sequence:CCGGCCAAAGGAAATGGTACAATTTCTCGAGAAATTGTACCATTTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133724
VALIDATED
BLOC1S4 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133724.3-67s21c1
Sequence:CCGGTCGAGAGGTCTCTACCGAGGACTCGAGTCCTCGGTAGAGACCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-543s21c1
Sequence:CCGGGGAGGCTGCTGCATACCATCACTCGAGTGATGGTATGCAGCAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-803s21c1
Sequence:CCGGCGACTTGACATCGTCAGTATTCTCGAGAATACTGACGATGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-326s21c1
Sequence:CCGGTTCGTGGGCATGCTGGACATGCTCGAGCATGTCCAGCATGCCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-614s21c1
Sequence:CCGGTACGAGCCGCCAGTCCTGTTTCTCGAGAAACAGGACTGGCGGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133724
VALIDATED
BLOC1S4 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133724.3-67s21c1
Sequence:CCGGTCGAGAGGTCTCTACCGAGGACTCGAGTCCTCGGTAGAGACCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-543s21c1
Sequence:CCGGGGAGGCTGCTGCATACCATCACTCGAGTGATGGTATGCAGCAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-803s21c1
Sequence:CCGGCGACTTGACATCGTCAGTATTCTCGAGAATACTGACGATGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-326s21c1
Sequence:CCGGTTCGTGGGCATGCTGGACATGCTCGAGCATGTCCAGCATGCCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-614s21c1
Sequence:CCGGTACGAGCCGCCAGTCCTGTTTCTCGAGAAACAGGACTGGCGGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133724
VALIDATED
BLOC1S4 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133724.3-67s21c1
Sequence:CCGGTCGAGAGGTCTCTACCGAGGACTCGAGTCCTCGGTAGAGACCTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-543s21c1
Sequence:CCGGGGAGGCTGCTGCATACCATCACTCGAGTGATGGTATGCAGCAGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-803s21c1
Sequence:CCGGCGACTTGACATCGTCAGTATTCTCGAGAATACTGACGATGTCAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-326s21c1
Sequence:CCGGTTCGTGGGCATGCTGGACATGCTCGAGCATGTCCAGCATGCCCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133724.3-614s21c1
Sequence:CCGGTACGAGCCGCCAGTCCTGTTTCTCGAGAAACAGGACTGGCGGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks