EMAIL THIS PAGE TO A FRIEND

BLOC1S5

biogenesis of lysosomal organelles complex-1, subunit 5, muted

149 Gene Product Result for
Synonyms: BLOS5 MU MUTED
Gene ID:
Human(63915) Summary: This gene encodes a component of BLOC-1 (biogenesis of lysosome-related organelles complex 1). Components of this complex are involved in the biogenesis of organelles such as melanosomes and platelet-dense granules. A mouse model for Hermansky-Pudlak Syndrome is mutated in the murine version of this gene. Alternative splicing results in multiple transcript variants. Read-through transcription exists between this gene and the upstream EEF1E1 (eukaryotic translation elongation factor 1 epsilon 1) gene, as well as with the downstream TXNDC5 (thioredoxin domain containing 5) gene. [provided by RefSeq, Dec 2010]
Mouse(17828) biogenesis of organelles complex-1, subunit 5, muted
Rat(306868) biogenesis of lysosomal organelles complex-1, subunit 5, muted
naked mole-rat(101706841) biogenesis of lysosomal organelles complex-1, subunit 5, muted
domestic guinea pig(100721323) biogenesis of lysosomal organelles complex-1, subunit 5, muted
sheep(101107314) biogenesis of lysosomal organelles complex-1, subunit 5, muted
chicken(420866) muted homolog (mouse)
domestic cat(101098141) biogenesis of lysosomal organelles complex-1, subunit 5, muted
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_201280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_201280 Rosetta Predictions human pricing
NM_001107347 Rosetta Predictions rat pricing
NM_139063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211116 predicted 667
2 SASI_Hs01_00211117 predicted 370
3 SASI_Hs01_00211118 predicted 671
4 SASI_Hs01_00211119 predicted 687
5 SASI_Hs01_00211120 predicted 277
6 SASI_Hs01_00211122 predicted 250
7 SASI_Hs01_00211123 predicted 357
8 SASI_Hs01_00211124 predicted 285
9 SASI_Hs02_00372916 predicted 381
10 SASI_Hs02_00372917 predicted 750
11 SASI_Hs01_00211121 predicted 621
12 SASI_Hs01_00211125 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227925 predicted 222
2 SASI_Rn02_00227926 predicted 947
3 SASI_Rn02_00227927 predicted 389
4 SASI_Rn02_00227928 predicted 887
5 SASI_Rn02_00227929 predicted 962
6 SASI_Rn02_00227930 predicted 847
7 SASI_Rn02_00227931 predicted 953
8 SASI_Rn02_00227932 predicted 930
9 SASI_Rn02_00227933 predicted 960
10 SASI_Rn02_00227934 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063842 predicted 211
2 SASI_Mm01_00063843 predicted 281
3 SASI_Mm01_00063844 predicted 1001
4 SASI_Mm01_00063845 predicted 422
5 SASI_Mm01_00063846 predicted 269
6 SASI_Mm01_00063847 predicted 943
7 SASI_Mm01_00063848 predicted 926
8 SASI_Mm01_00063849 predicted 297
9 SASI_Mm01_00063850 predicted 378
10 SASI_Mm01_00063851 predicted 687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139063
VALIDATED
BLOC1S5 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-445s21c1
Sequence:CCGGAGGTGATTAATGACTACTTGACTCGAGTCAAGTAGTCATTAATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-173s21c1
Sequence:CCGGGGATCTTGGAGAGATTCATTCCTCGAGGAATGAATCTCTCCAAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-272s21c1
Sequence:CCGGTCGAGAATTGCGCGTTCTTAACTCGAGTTAAGAACGCGCAATTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-212s21c1
Sequence:CCGGACCAGTTACCCAAGGTGAAATCTCGAGATTTCACCTTGGGTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139063.1-1357s21c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-159s1c1
Sequence:CCGGCACCTCATTATCAAGGATCTTCTCGAGAAGATCCTTGATAATGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139063.1-221s1c1
Sequence:CCGGCCAAGGTGAAATCCGTTACTTCTCGAGAAGTAACGGATTTCACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139063.1-1357s1c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-158s1c1
Sequence:CCGGGCACCTCATTATCAAGGATCTCTCGAGAGATCCTTGATAATGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139063
VALIDATED
BLOC1S5 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-445s21c1
Sequence:CCGGAGGTGATTAATGACTACTTGACTCGAGTCAAGTAGTCATTAATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-173s21c1
Sequence:CCGGGGATCTTGGAGAGATTCATTCCTCGAGGAATGAATCTCTCCAAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-272s21c1
Sequence:CCGGTCGAGAATTGCGCGTTCTTAACTCGAGTTAAGAACGCGCAATTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-212s21c1
Sequence:CCGGACCAGTTACCCAAGGTGAAATCTCGAGATTTCACCTTGGGTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139063.1-1357s21c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-159s1c1
Sequence:CCGGCACCTCATTATCAAGGATCTTCTCGAGAAGATCCTTGATAATGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139063.1-221s1c1
Sequence:CCGGCCAAGGTGAAATCCGTTACTTCTCGAGAAGTAACGGATTTCACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139063.1-1357s1c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-158s1c1
Sequence:CCGGGCACCTCATTATCAAGGATCTCTCGAGAGATCCTTGATAATGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139063
VALIDATED
BLOC1S5 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-445s21c1
Sequence:CCGGAGGTGATTAATGACTACTTGACTCGAGTCAAGTAGTCATTAATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-173s21c1
Sequence:CCGGGGATCTTGGAGAGATTCATTCCTCGAGGAATGAATCTCTCCAAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-272s21c1
Sequence:CCGGTCGAGAATTGCGCGTTCTTAACTCGAGTTAAGAACGCGCAATTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139063.1-212s21c1
Sequence:CCGGACCAGTTACCCAAGGTGAAATCTCGAGATTTCACCTTGGGTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139063.1-1357s21c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-159s1c1
Sequence:CCGGCACCTCATTATCAAGGATCTTCTCGAGAAGATCCTTGATAATGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139063.1-221s1c1
Sequence:CCGGCCAAGGTGAAATCCGTTACTTCTCGAGAAGTAACGGATTTCACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139063.1-1357s1c1
Sequence:CCGGCCCACACTGATGATGATGTATCTCGAGATACATCATCATCAGTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_139063.1-158s1c1
Sequence:CCGGGCACCTCATTATCAAGGATCTCTCGAGAGATCCTTGATAATGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201280
VALIDATED
BLOC1S5 MISSION shRNA Bacterial Glycerol Stock
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-434s21c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-369s21c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-897s21c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-1260s21c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201280.1-441s1c1
Sequence:CCGGGTAGCTAGTGAGAAACAGCATCTCGAGATGCTGTTTCTCACTAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201280.1-378s1c1
Sequence:CCGGGACTCAGTCTGTAGACTCCAACTCGAGTTGGAGTCTACAGACTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-434s1c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-897s1c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-1260s1c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-369s1c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201280
VALIDATED
BLOC1S5 MISSION shRNA shRNA Plasmid DNA
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-434s21c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-369s21c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-897s21c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-1260s21c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201280.1-441s1c1
Sequence:CCGGGTAGCTAGTGAGAAACAGCATCTCGAGATGCTGTTTCTCACTAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201280.1-378s1c1
Sequence:CCGGGACTCAGTCTGTAGACTCCAACTCGAGTTGGAGTCTACAGACTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-434s1c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-897s1c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-1260s1c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-369s1c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201280
VALIDATED
BLOC1S5 MISSION shRNA Lentiviral Transduction Particles
biogenesis of lysosomal organelles complex-1, subunit 5, muted
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-434s21c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201280.1-369s21c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-897s21c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_201280.1-1260s21c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201280.1-441s1c1
Sequence:CCGGGTAGCTAGTGAGAAACAGCATCTCGAGATGCTGTTTCTCACTAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201280.1-378s1c1
Sequence:CCGGGACTCAGTCTGTAGACTCCAACTCGAGTTGGAGTCTACAGACTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-434s1c1
Sequence:CCGGCCACTTAGTAGCTAGTGAGAACTCGAGTTCTCACTAGCTACTAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-897s1c1
Sequence:CCGGGCTCAGAGAACTGTAGGTATACTCGAGTATACCTACAGTTCTCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-1260s1c1
Sequence:CCGGGCCTTCCAGCACTTACTATTTCTCGAGAAATAGTAAGTGCTGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201280.1-369s1c1
Sequence:CCGGGCAGCTAATGACTCAGTCTGTCTCGAGACAGACTGAGTCATTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)