EMAIL THIS PAGE TO A FRIEND

BLVRA

biliverdin reductase A

66 Gene Product Result for
Synonyms: BLVR BVR BVRA
UniProtKB ID: P53004, A8K747, O95019, Q86UX0, Q96QL4, Q9BRW8
Gene ID:
Human(644) Summary: The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(109778) biliverdin reductase A
Rat(116599) biliverdin reductase A
Zebrafish(767661) biliverdin reductase A
domestic cat(101088735) biliverdin reductase A
cow(504596) biliverdin reductase A
chicken(420776) biliverdin reductase A
dog(475867) biliverdin reductase A
naked mole-rat(101722954) biliverdin reductase A
domestic guinea pig(100720346) biliverdin reductase A
sheep(101118353) biliverdin reductase A
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B8437 Anti-Biliverdin Reductase A antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation, western blot pricing
B1188 Anti-BLVRA (216-230) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405518 Anti-BLVRA antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA054322 Anti-BLVRA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA042865 Anti-BLVRA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1411260 Anti-BLVRA antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA019709 Anti-BLVRA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
B3687 Biliverdin Reductase A human recombinant, expressed in E. coli, ≥90% (SDS-PAGE), buffered aqueous solution pricing
WH0000644M1 Monoclonal Anti-BLVRA antibody produced in mouse clone 4G4-2B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403608 Monoclonal Anti-BLVRA antibody produced in mouse clone S2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000712 Rosetta Predictions human pricing
NM_053850 Rosetta Predictions rat pricing
NM_026678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235981 predicted 803
2 SASI_Hs01_00235983 predicted 655
3 SASI_Hs01_00235984 predicted 253
4 SASI_Hs02_00303119 predicted 466
5 SASI_Hs01_00235985 predicted 753
6 SASI_Hs02_00303120 predicted 652
7 SASI_Hs01_00235986 predicted 515
8 SASI_Hs01_00235987 predicted 530
9 SASI_Hs01_00235989 predicted 231
10 SASI_Hs01_00235990 predicted 544
11 SASI_Hs01_00235982 predicted 788
12 SASI_Hs01_00235988 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086634 predicted 577
2 SASI_Rn01_00086635 predicted 205
3 SASI_Rn01_00086636 predicted 304
4 SASI_Rn01_00086637 predicted 743
5 SASI_Rn01_00086638 predicted 287
6 SASI_Rn02_00266705 predicted 772
7 SASI_Rn01_00086639 predicted 848
8 SASI_Rn01_00086640 predicted 362
9 SASI_Rn01_00086641 predicted 229
10 SASI_Rn01_00086643 predicted 243
11 SASI_Rn01_00086642 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107497 predicted 902
2 SASI_Mm01_00107498 predicted 397
3 SASI_Mm01_00107499 predicted 860
4 SASI_Mm02_00330707 predicted 833
5 SASI_Mm01_00107500 predicted 324
6 SASI_Mm02_00330708 predicted 205
7 SASI_Mm01_00107503 predicted 904
8 SASI_Mm01_00107504 predicted 293
9 SASI_Mm02_00330709 predicted 863
10 SASI_Mm02_00330710 predicted 560
11 SASI_Mm01_00107496 predicted 325
12 SASI_Mm01_00107501 predicted 413
13 SASI_Mm01_00107502 predicted 376
14 SASI_Mm01_00107505 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026678
VALIDATED
BLVRA MISSION shRNA Bacterial Glycerol Stock
biliverdin reductase A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-387s21c2
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-870s21c3
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-421s21c3
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-911s21c2
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-328s1c1
Sequence:CCGGCCTTGATAATGTACGGCAGATCTCGAGATCTGCCGTACATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-901s1c1
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-377s1c1
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-860s1c1
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-411s1c1
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026678
VALIDATED
BLVRA MISSION shRNA shRNA Plasmid DNA
biliverdin reductase A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-387s21c2
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-870s21c3
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-421s21c3
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-911s21c2
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-328s1c1
Sequence:CCGGCCTTGATAATGTACGGCAGATCTCGAGATCTGCCGTACATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-901s1c1
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-377s1c1
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-860s1c1
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-411s1c1
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026678
VALIDATED
BLVRA MISSION shRNA Lentiviral Transduction Particles
biliverdin reductase A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-387s21c2
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-870s21c3
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-421s21c3
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026678.4-911s21c2
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-328s1c1
Sequence:CCGGCCTTGATAATGTACGGCAGATCTCGAGATCTGCCGTACATTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-901s1c1
Sequence:CCGGGCCAAATGTAGGAGTCAATAACTCGAGTTATTGACTCCTACATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-377s1c1
Sequence:CCGGGAGGTTGATGTCGCCTATATTCTCGAGAATATAGGCGACATCAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-860s1c1
Sequence:CCGGCATATAAGCATCCACTTCAAACTCGAGTTTGAAGTGGATGCTTATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026678.3-411s1c1
Sequence:CCGGCCAGCCACGAAGACTATATAACTCGAGTTATATAGTCTTCGTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000712
VALIDATED
BLVRA MISSION shRNA Bacterial Glycerol Stock
biliverdin reductase A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-338s21c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-804s21c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-184s21c1
Sequence:CCGGCAGCGTTCCTGAACCTGATTGCTCGAGCAATCAGGTTCAGGAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-281s21c1
Sequence:CCGGAGAGGTGGAGGTCGCCTATATCTCGAGATATAGGCGACCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000712.3-659s21c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-776s1c1
Sequence:CCGGCCATTTCAAGTCTGGGTCCTTCTCGAGAAGGACCCAGACTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-659s1c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-936s1c1
Sequence:CCGGGCAGAAGAAATCCAGAAATATCTCGAGATATTTCTGGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-338s1c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-804s1c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000712
VALIDATED
BLVRA MISSION shRNA shRNA Plasmid DNA
biliverdin reductase A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-338s21c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-804s21c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-184s21c1
Sequence:CCGGCAGCGTTCCTGAACCTGATTGCTCGAGCAATCAGGTTCAGGAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-281s21c1
Sequence:CCGGAGAGGTGGAGGTCGCCTATATCTCGAGATATAGGCGACCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000712.3-659s21c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-776s1c1
Sequence:CCGGCCATTTCAAGTCTGGGTCCTTCTCGAGAAGGACCCAGACTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-659s1c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-936s1c1
Sequence:CCGGGCAGAAGAAATCCAGAAATATCTCGAGATATTTCTGGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-338s1c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-804s1c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000712
VALIDATED
BLVRA MISSION shRNA Lentiviral Transduction Particles
biliverdin reductase A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-338s21c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-804s21c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-184s21c1
Sequence:CCGGCAGCGTTCCTGAACCTGATTGCTCGAGCAATCAGGTTCAGGAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000712.3-281s21c1
Sequence:CCGGAGAGGTGGAGGTCGCCTATATCTCGAGATATAGGCGACCTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000712.3-659s21c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-776s1c1
Sequence:CCGGCCATTTCAAGTCTGGGTCCTTCTCGAGAAGGACCCAGACTTGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000712.3-659s1c1
Sequence:CCGGGCGAAAGGAAGATCAGTATATCTCGAGATATACTGATCTTCCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-936s1c1
Sequence:CCGGGCAGAAGAAATCCAGAAATATCTCGAGATATTTCTGGATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-338s1c1
Sequence:CCGGGCAGTTCCTTAATGCTGGCAACTCGAGTTGCCAGCATTAAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_000712.3-804s1c1
Sequence:CCGGGTGCCAAATGTAGGAGTGAATCTCGAGATTCACTCCTACATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks