EMAIL THIS PAGE TO A FRIEND

BLVRB

biliverdin reductase B (flavin reductase (NADPH))

58 Gene Product Result for
Synonyms: BVRB FLR SDR43U1
UniProtKB ID: P30043, A6NKD8, B2R5C6, P32078, P53005, Q32LZ2
Gene ID:
Human(645) Summary: The final step in heme metabolism in mammals is catalyzed by the cytosolic biliverdin reductase enzymes A and B (EC 1.3.1.24).[supplied by OMIM, Jul 2009]
Mouse(233016) biliverdin reductase B (flavin reductase (NADPH))
Rat(292737) biliverdin reductase B (flavin reductase (NADPH))
sheep(101119750) biliverdin reductase B (flavin reductase (NADPH))
domestic guinea pig(100723970) biliverdin reductase B (flavin reductase (NADPH))
naked mole-rat(101697384) biliverdin reductase B (flavin reductase (NADPH))
Zebrafish(436959) biliverdin reductase B (flavin reductase (NADPH))
domestic cat(101092315) biliverdin reductase B (flavin reductase (NADPH))
cow(281650) biliverdin reductase B (flavin reductase (NADPH))
dog(476456) biliverdin reductase B (flavin reductase (NADPH))
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000713 Rosetta Predictions human pricing
NM_001106236 Rosetta Predictions rat pricing
NM_144923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303121 predicted 613
2 SASI_Hs01_00228935 predicted 562
3 SASI_Hs02_00303122 predicted 423
4 SASI_Hs02_00303123 predicted 364
5 SASI_Hs01_00228937 predicted 568
6 SASI_Hs01_00228938 predicted 580
7 SASI_Hs01_00228939 predicted 492
8 SASI_Hs01_00228940 predicted 276
9 SASI_Hs02_00303124 predicted 193
10 SASI_Hs01_00228942 predicted 424
11 SASI_Hs01_00228936 predicted 345
12 SASI_Hs01_00228941 predicted 253
13 SASI_Hs01_00228943 predicted 491
14 SASI_Hs01_00228944 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216978 predicted 380
2 SASI_Rn02_00216979 predicted 376
3 SASI_Rn02_00216980 predicted 348
4 SASI_Rn02_00216981 predicted 528
5 SASI_Rn02_00216982 predicted 564
6 SASI_Rn02_00216983 predicted 530
7 SASI_Rn02_00216984 predicted 528
8 SASI_Rn02_00216985 predicted 560
9 SASI_Rn02_00216986 predicted 549
10 SASI_Rn02_00216987 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172635 predicted 276
2 SASI_Mm02_00340417 predicted 547
3 SASI_Mm01_00172636 predicted 371
4 SASI_Mm01_00172637 predicted 589
5 SASI_Mm01_00172638 predicted 519
6 SASI_Mm01_00172639 predicted 528
7 SASI_Mm01_00172640 predicted 325
8 SASI_Mm01_00172643 predicted 342
9 SASI_Mm01_00172644 predicted 334
10 SASI_Mm02_00340418 predicted 419
11 SASI_Mm01_00172641 predicted 381
12 SASI_Mm01_00172642 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000713
VALIDATED
BLVRB MISSION shRNA Bacterial Glycerol Stock
biliverdin reductase B (flavin reductase (NADPH))
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000046378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-567s1c1
Sequence:CCGGACATAGGAGACCAGCCACTAACTCGAGTTAGTGGCTGGTCTCCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000713.1-349s1c1
Sequence:CCGGCCTCAGTCCCACGACAGTTATCTCGAGATAACTGTCGTGGGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-538s1c1
Sequence:CCGGCCTGAAGTACGTGGCTGTGATCTCGAGATCACAGCCACGTACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000713
VALIDATED
BLVRB MISSION shRNA shRNA Plasmid DNA
biliverdin reductase B (flavin reductase (NADPH))
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000046378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-567s1c1
Sequence:CCGGACATAGGAGACCAGCCACTAACTCGAGTTAGTGGCTGGTCTCCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000713.1-349s1c1
Sequence:CCGGCCTCAGTCCCACGACAGTTATCTCGAGATAACTGTCGTGGGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-538s1c1
Sequence:CCGGCCTGAAGTACGTGGCTGTGATCTCGAGATCACAGCCACGTACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000713
VALIDATED
BLVRB MISSION shRNA Lentiviral Transduction Particles
biliverdin reductase B (flavin reductase (NADPH))
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000046378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-567s1c1
Sequence:CCGGACATAGGAGACCAGCCACTAACTCGAGTTAGTGGCTGGTCTCCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000713.1-349s1c1
Sequence:CCGGCCTCAGTCCCACGACAGTTATCTCGAGATAACTGTCGTGGGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000713.1-538s1c1
Sequence:CCGGCCTGAAGTACGTGGCTGTGATCTCGAGATCACAGCCACGTACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144923
VALIDATED
BLVRB MISSION shRNA Bacterial Glycerol Stock
biliverdin reductase B (flavin reductase (NADPH))
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-569s1c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-380s1c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-416s1c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-540s1c1
Sequence:CCGGCGGATGCATAAGATTCTGCAACTCGAGTTGCAGAATCTTATGCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-712s1c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-380s21c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-712s21c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-569s21c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-416s21c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144923
VALIDATED
BLVRB MISSION shRNA shRNA Plasmid DNA
biliverdin reductase B (flavin reductase (NADPH))
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-569s1c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-380s1c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-416s1c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-540s1c1
Sequence:CCGGCGGATGCATAAGATTCTGCAACTCGAGTTGCAGAATCTTATGCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-712s1c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-380s21c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-712s21c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-569s21c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-416s21c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144923
VALIDATED
BLVRB MISSION shRNA Lentiviral Transduction Particles
biliverdin reductase B (flavin reductase (NADPH))
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-569s1c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-380s1c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-416s1c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144923.2-540s1c1
Sequence:CCGGCGGATGCATAAGATTCTGCAACTCGAGTTGCAGAATCTTATGCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144923.2-712s1c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-380s21c1
Sequence:CCGGCCTCAGTCCCACTACAGTAATCTCGAGATTACTGTAGTGGGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-712s21c1
Sequence:CCGGCCAATGAGTATGACGGACACACTCGAGTGTGTCCGTCATACTCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-569s21c1
Sequence:CCGGGCTGAAATACGTGGCAGTGATCTCGAGATCACTGCCACGTATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144923.3-416s21c1
Sequence:CCGGGAACATCGTGACAGCCATGAACTCGAGTTCATGGCTGTCACGATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)