EMAIL THIS PAGE TO A FRIEND

BLZF1

basic leucine zipper nuclear factor 1

Synonyms: GOLGIN-45 JEM-1 JEM-1s JEM1
UniProtKB ID: Q9H2G9, O15298, Q5T531, Q5T533, Q9GZX4
Gene ID:
Mouse(66352) basic leucine zipper nuclear factor 1
Rat(498266) basic leucine zipper nuclear factor 1
Zebrafish(114452) basic leucine zipper nuclear factor 1
dog(490354) basic leucine zipper nuclear factor 1
chicken(418371) basic leucine zipper nuclear factor 1
domestic cat(101083055) basic leucine zipper nuclear factor 1
cow(504820) basic leucine zipper nuclear factor 1
Horse(100058289) basic leucine zipper nuclear factor 1
naked mole-rat(101701467) basic leucine zipper nuclear factor 1
domestic guinea pig(100715595) basic leucine zipper nuclear factor 1
sheep(101122875) basic leucine zipper nuclear factor 1
Domestic Rabbit(100348078) basic leucine zipper nuclear factor 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003666 Rosetta Predictions human pricing
NM_001017494 Rosetta Predictions rat pricing
NM_025505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073080 predicted 771
2 SASI_Hs01_00073081 predicted 1363
3 SASI_Hs01_00073083 predicted 1208
4 SASI_Hs02_00336050 predicted 1198
5 SASI_Hs01_00073085 predicted 953
6 SASI_Hs01_00073086 predicted 1183
7 SASI_Hs01_00073087 predicted 1465
8 SASI_Hs01_00073088 predicted 832
9 SASI_Hs01_00073089 predicted 1041
10 SASI_Hs02_00336051 predicted 453
11 SASI_Hs01_00073082 predicted 1052
12 SASI_Hs01_00073084 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017494 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085962 predicted 1235
2 SASI_Rn02_00202314 predicted 849
3 SASI_Rn02_00202315 predicted 1302
4 SASI_Rn01_00085964 predicted 383
5 SASI_Rn01_00085965 predicted 782
6 SASI_Rn01_00085967 predicted 297
7 SASI_Rn01_00085968 predicted 1227
8 SASI_Rn01_00085969 predicted 832
9 SASI_Rn01_00085970 predicted 673
10 SASI_Rn01_00085971 predicted 390
11 SASI_Rn01_00085963 predicted 1400
12 SASI_Rn01_00085966 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168241 predicted 1504
2 SASI_Mm01_00168242 predicted 1475
3 SASI_Mm01_00168244 predicted 986
4 SASI_Mm01_00168245 predicted 603
5 SASI_Mm02_00328385 predicted 454
6 SASI_Mm01_00168246 predicted 635
7 SASI_Mm01_00168248 predicted 592
8 SASI_Mm01_00168249 predicted 1376
9 SASI_Mm01_00168250 predicted 988
10 SASI_Mm02_00328386 predicted 838
11 SASI_Mm01_00168243 predicted 561
12 SASI_Mm01_00168247 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003666
BLZF1 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper nuclear factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003666.2-1964s21c1
Sequence:CCGGTAACTTGAAACCGCTCCATTTCTCGAGAAATGGAGCGGTTTCAAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-949s21c1
Sequence:CCGGATGATCTTCAGTATCACTTTGCTCGAGCAAAGTGATACTGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-769s21c1
Sequence:CCGGGTCAGTCAGAGGGAGTTATAGCTCGAGCTATAACTCCCTCTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1197s1c1
Sequence:CCGGCGGGAACAGTTTCGTCAAGAACTCGAGTTCTTGACGAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003666.2-1992s1c1
Sequence:CCGGGCACATTTACTGTTTCTGTTACTCGAGTAACAGAAACAGTAAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1483s1c1
Sequence:CCGGGCAAAGAGAGTTCACCTGATACTCGAGTATCAGGTGAACTCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-522s1c1
Sequence:CCGGCCACCTAAATCTGTTGAAGTTCTCGAGAACTTCAACAGATTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1056s1c1
Sequence:CCGGCGTATGTCAATACAGTGTGATCTCGAGATCACACTGTATTGACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003666
BLZF1 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper nuclear factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003666.2-1964s21c1
Sequence:CCGGTAACTTGAAACCGCTCCATTTCTCGAGAAATGGAGCGGTTTCAAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-949s21c1
Sequence:CCGGATGATCTTCAGTATCACTTTGCTCGAGCAAAGTGATACTGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-769s21c1
Sequence:CCGGGTCAGTCAGAGGGAGTTATAGCTCGAGCTATAACTCCCTCTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1197s1c1
Sequence:CCGGCGGGAACAGTTTCGTCAAGAACTCGAGTTCTTGACGAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003666.2-1992s1c1
Sequence:CCGGGCACATTTACTGTTTCTGTTACTCGAGTAACAGAAACAGTAAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1483s1c1
Sequence:CCGGGCAAAGAGAGTTCACCTGATACTCGAGTATCAGGTGAACTCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-522s1c1
Sequence:CCGGCCACCTAAATCTGTTGAAGTTCTCGAGAACTTCAACAGATTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1056s1c1
Sequence:CCGGCGTATGTCAATACAGTGTGATCTCGAGATCACACTGTATTGACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003666
BLZF1 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper nuclear factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003666.2-1964s21c1
Sequence:CCGGTAACTTGAAACCGCTCCATTTCTCGAGAAATGGAGCGGTTTCAAGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-949s21c1
Sequence:CCGGATGATCTTCAGTATCACTTTGCTCGAGCAAAGTGATACTGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003666.2-769s21c1
Sequence:CCGGGTCAGTCAGAGGGAGTTATAGCTCGAGCTATAACTCCCTCTGACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1197s1c1
Sequence:CCGGCGGGAACAGTTTCGTCAAGAACTCGAGTTCTTGACGAAACTGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003666.2-1992s1c1
Sequence:CCGGGCACATTTACTGTTTCTGTTACTCGAGTAACAGAAACAGTAAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1483s1c1
Sequence:CCGGGCAAAGAGAGTTCACCTGATACTCGAGTATCAGGTGAACTCTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-522s1c1
Sequence:CCGGCCACCTAAATCTGTTGAAGTTCTCGAGAACTTCAACAGATTTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003666.2-1056s1c1
Sequence:CCGGCGTATGTCAATACAGTGTGATCTCGAGATCACACTGTATTGACATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025505
VALIDATED
BLZF1 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper nuclear factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-831s21c1
Sequence:CCGGATGACCCGCAGTATCACTTTGCTCGAGCAAAGTGATACTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-431s21c1
Sequence:CCGGCACGGAGTCCAACCCATAAATCTCGAGATTTATGGGTTGGACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1445s21c1
Sequence:CCGGTTCCATCCCTATACCAGATATCTCGAGATATCTGGTATAGGGATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1645s21c1
Sequence:CCGGGTACTGGATTCCAGATTATTTCTCGAGAAATAATCTGGAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-954s21c1
Sequence:CCGGGCGATGTCTGGAGAAGTAAATCTCGAGATTTACTTCTCCAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025505.2-3024s1c1
Sequence:CCGGCCTGCCTATCTCAGACAGTAACTCGAGTTACTGTCTGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025505.2-939s1c1
Sequence:CCGGCGGATGTCAATACAGTGCGATCTCGAGATCGCACTGTATTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-1380s1c1
Sequence:CCGGCCGGACAACCAATTTGCTGAACTCGAGTTCAGCAAATTGGTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-599s1c1
Sequence:CCGGCACCAAGAACACAAAGGTTAACTCGAGTTAACCTTTGTGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-773s1c1
Sequence:CCGGCCGAGTACAGACAGAGATAAACTCGAGTTTATCTCTGTCTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025505
VALIDATED
BLZF1 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper nuclear factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-831s21c1
Sequence:CCGGATGACCCGCAGTATCACTTTGCTCGAGCAAAGTGATACTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-431s21c1
Sequence:CCGGCACGGAGTCCAACCCATAAATCTCGAGATTTATGGGTTGGACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1445s21c1
Sequence:CCGGTTCCATCCCTATACCAGATATCTCGAGATATCTGGTATAGGGATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1645s21c1
Sequence:CCGGGTACTGGATTCCAGATTATTTCTCGAGAAATAATCTGGAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-954s21c1
Sequence:CCGGGCGATGTCTGGAGAAGTAAATCTCGAGATTTACTTCTCCAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025505.2-3024s1c1
Sequence:CCGGCCTGCCTATCTCAGACAGTAACTCGAGTTACTGTCTGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025505.2-939s1c1
Sequence:CCGGCGGATGTCAATACAGTGCGATCTCGAGATCGCACTGTATTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-1380s1c1
Sequence:CCGGCCGGACAACCAATTTGCTGAACTCGAGTTCAGCAAATTGGTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-599s1c1
Sequence:CCGGCACCAAGAACACAAAGGTTAACTCGAGTTAACCTTTGTGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-773s1c1
Sequence:CCGGCCGAGTACAGACAGAGATAAACTCGAGTTTATCTCTGTCTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025505
VALIDATED
BLZF1 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper nuclear factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-831s21c1
Sequence:CCGGATGACCCGCAGTATCACTTTGCTCGAGCAAAGTGATACTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-431s21c1
Sequence:CCGGCACGGAGTCCAACCCATAAATCTCGAGATTTATGGGTTGGACTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1445s21c1
Sequence:CCGGTTCCATCCCTATACCAGATATCTCGAGATATCTGGTATAGGGATGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-1645s21c1
Sequence:CCGGGTACTGGATTCCAGATTATTTCTCGAGAAATAATCTGGAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025505.4-954s21c1
Sequence:CCGGGCGATGTCTGGAGAAGTAAATCTCGAGATTTACTTCTCCAGACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025505.2-3024s1c1
Sequence:CCGGCCTGCCTATCTCAGACAGTAACTCGAGTTACTGTCTGAGATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025505.2-939s1c1
Sequence:CCGGCGGATGTCAATACAGTGCGATCTCGAGATCGCACTGTATTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-1380s1c1
Sequence:CCGGCCGGACAACCAATTTGCTGAACTCGAGTTCAGCAAATTGGTTGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-599s1c1
Sequence:CCGGCACCAAGAACACAAAGGTTAACTCGAGTTAACCTTTGTGTTCTTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025505.2-773s1c1
Sequence:CCGGCCGAGTACAGACAGAGATAAACTCGAGTTTATCTCTGTCTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks