EMAIL THIS PAGE TO A FRIEND

BMF

Bcl2 modifying factor

272 Gene Product Result for
Gene ID:
Human(90427) Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an apoptotic activator. This protein is found to be sequestered to myosin V motors by its association with dynein light chain 2, which may be important for sensing intracellular damage and triggering apoptosis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(171543) BCL2 modifying factor
Rat(246142) Bcl2 modifying factor
chicken(769140) Bcl2 modifying factor
cow(541141) Bcl2 modifying factor
dog(607313) Bcl2 modifying factor
domestic cat(768268) Bcl2 modifying factor
domestic cat(101091452) Bcl2 modifying factor
domestic guinea pig(100728449) Bcl2 modifying factor
naked mole-rat(101704986) Bcl2 modifying factor
Goat(100860972) Bcl2 modifying factor
sheep(101108051) Bcl2 modifying factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003940 Rosetta Predictions human pricing
NM_001003942 Rosetta Predictions human pricing
NM_001003943 Rosetta Predictions human pricing
NM_033503 Rosetta Predictions human pricing
NM_139258 Rosetta Predictions rat pricing
NM_138313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127817 predicted 940
2 SASI_Hs01_00127818 predicted 324
3 SASI_Hs01_00127820 predicted 961
4 SASI_Hs01_00127821 predicted 1142
5 SASI_Hs01_00127822 predicted 535
6 SASI_Hs01_00127823 predicted 724
7 SASI_Hs01_00127824 predicted 524
8 SASI_Hs01_00127825 predicted 680
9 SASI_Hs01_00127826 predicted 730
10 SASI_Hs02_00304429 predicted 614
11 SASI_Hs01_00127819 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065967 predicted 636
2 SASI_Hs01_00065968 predicted 90
3 SASI_Hs01_00065970 predicted 657
4 SASI_Hs01_00065971 predicted 850
5 SASI_Hs01_00065972 predicted 309
6 SASI_Hs01_00065973 predicted 426
7 SASI_Hs01_00065974 predicted 293
8 SASI_Hs01_00065975 predicted 431
9 SASI_Hs01_00065976 predicted 132
10 SASI_Hs02_00304431 predicted 725
11 SASI_Hs01_00065969 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207683 predicted 543
2 SASI_Hs01_00207684 predicted 90
3 SASI_Hs01_00207686 predicted 558
4 SASI_Hs01_00207687 predicted 750
5 SASI_Hs01_00207688 predicted 323
6 SASI_Hs01_00207689 predicted 336
7 SASI_Hs01_00207690 predicted 134
8 SASI_Hs01_00207691 predicted 620
9 SASI_Hs02_00304432 predicted 76
10 SASI_Hs01_00207692 predicted 655
11 SASI_Hs01_00207685 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206414 predicted 786
2 SASI_Hs01_00206415 predicted 174
3 SASI_Hs01_00206417 predicted 803
4 SASI_Hs01_00206418 predicted 997
5 SASI_Hs01_00206419 predicted 391
6 SASI_Hs01_00206420 predicted 570
7 SASI_Hs01_00206421 predicted 384
8 SASI_Hs01_00206422 predicted 528
9 SASI_Hs01_00206423 predicted 583
10 SASI_Hs02_00361374 predicted 468
11 SASI_Hs01_00206416 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033324 predicted 847
2 SASI_Rn01_00033325 predicted 1187
3 SASI_Rn01_00033326 predicted 246
4 SASI_Rn01_00033327 predicted 1075
5 SASI_Rn01_00033328 predicted 1003
6 SASI_Rn01_00033329 predicted 843
7 SASI_Rn01_00033330 predicted 821
8 SASI_Rn01_00033332 predicted 319
9 SASI_Rn02_00268550 predicted 636
10 SASI_Rn01_00033333 predicted 859
11 SASI_Rn01_00033331 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051011 predicted 910
2 SASI_Mm01_00051012 predicted 427
3 SASI_Mm01_00051013 predicted 1159
4 SASI_Mm01_00051014 predicted 1018
5 SASI_Mm01_00051015 predicted 879
6 SASI_Mm01_00051016 predicted 287
7 SASI_Mm01_00051017 predicted 1129
8 SASI_Mm01_00051019 predicted 1059
9 SASI_Mm01_00051020 predicted 591
10 SASI_Mm02_00339613 predicted 1091
11 SASI_Mm01_00051018 predicted 924
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033503
BMF MISSION shRNA Bacterial Glycerol Stock
Bcl2 modifying factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-612s1c1
Sequence:CCGGGAATGGAGAAGAGAACAGGAACTCGAGTTCCTGTTCTCTTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-603s1c1
Sequence:CCGGCCTTGCTTTGAATGGAGAAGACTCGAGTCTTCTCCATTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033503.2-1010s1c1
Sequence:CCGGCCAGAGGAACTCAGTTAAGAACTCGAGTTCTTAACTGAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-499s1c1
Sequence:CCGGCGAAAGCTTCAGTGCATTGCACTCGAGTGCAATGCACTGAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-607s1c1
Sequence:CCGGGCTTTGAATGGAGAAGAGAACCTCGAGGTTCTCTTCTCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-600s1c1
Sequence:CCGGCAACCTTGCTTTGAATGGAGACTCGAGTCTCCATTCAAAGCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-133s1c1
Sequence:CCGGGATGTGTTCCAACCAGAGGATCTCGAGATCCTCTGGTTGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033503
BMF MISSION shRNA shRNA Plasmid DNA
Bcl2 modifying factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-612s1c1
Sequence:CCGGGAATGGAGAAGAGAACAGGAACTCGAGTTCCTGTTCTCTTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-603s1c1
Sequence:CCGGCCTTGCTTTGAATGGAGAAGACTCGAGTCTTCTCCATTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033503.2-1010s1c1
Sequence:CCGGCCAGAGGAACTCAGTTAAGAACTCGAGTTCTTAACTGAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-499s1c1
Sequence:CCGGCGAAAGCTTCAGTGCATTGCACTCGAGTGCAATGCACTGAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-607s1c1
Sequence:CCGGGCTTTGAATGGAGAAGAGAACCTCGAGGTTCTCTTCTCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-600s1c1
Sequence:CCGGCAACCTTGCTTTGAATGGAGACTCGAGTCTCCATTCAAAGCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-133s1c1
Sequence:CCGGGATGTGTTCCAACCAGAGGATCTCGAGATCCTCTGGTTGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033503
BMF MISSION shRNA Lentiviral Transduction Particles
Bcl2 modifying factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-612s1c1
Sequence:CCGGGAATGGAGAAGAGAACAGGAACTCGAGTTCCTGTTCTCTTCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-603s1c1
Sequence:CCGGCCTTGCTTTGAATGGAGAAGACTCGAGTCTTCTCCATTCAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033503.2-1010s1c1
Sequence:CCGGCCAGAGGAACTCAGTTAAGAACTCGAGTTCTTAACTGAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-499s1c1
Sequence:CCGGCGAAAGCTTCAGTGCATTGCACTCGAGTGCAATGCACTGAAGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-607s1c1
Sequence:CCGGGCTTTGAATGGAGAAGAGAACCTCGAGGTTCTCTTCTCCATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033503.2-600s1c1
Sequence:CCGGCAACCTTGCTTTGAATGGAGACTCGAGTCTCCATTCAAAGCAAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033503.2-133s1c1
Sequence:CCGGGATGTGTTCCAACCAGAGGATCTCGAGATCCTCTGGTTGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138313
VALIDATED
BMF MISSION shRNA Bacterial Glycerol Stock
Bcl2 modifying factor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000009714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-2355s1c1
Sequence:CCGGGCCCAGAGTAAGGAATGTCTTCTCGAGAAGACATTCCTTACTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-720s1c1
Sequence:CCGGCATCGGCTTCATACGCAACAACTCGAGTTGTTGCGTATGAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-311s1c1
Sequence:CCGGGCTAGAAGATGATGTGTTCCACTCGAGTGGAACACATCATCTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-687s1c1
Sequence:CCGGGCCAGAAAGCTTCAGTGTATTCTCGAGAATACACTGAAGCTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138313
VALIDATED
BMF MISSION shRNA shRNA Plasmid DNA
Bcl2 modifying factor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000009714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-2355s1c1
Sequence:CCGGGCCCAGAGTAAGGAATGTCTTCTCGAGAAGACATTCCTTACTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-720s1c1
Sequence:CCGGCATCGGCTTCATACGCAACAACTCGAGTTGTTGCGTATGAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-311s1c1
Sequence:CCGGGCTAGAAGATGATGTGTTCCACTCGAGTGGAACACATCATCTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-687s1c1
Sequence:CCGGGCCAGAAAGCTTCAGTGTATTCTCGAGAATACACTGAAGCTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138313
VALIDATED
BMF MISSION shRNA Lentiviral Transduction Particles
Bcl2 modifying factor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000009714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-2355s1c1
Sequence:CCGGGCCCAGAGTAAGGAATGTCTTCTCGAGAAGACATTCCTTACTCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-720s1c1
Sequence:CCGGCATCGGCTTCATACGCAACAACTCGAGTTGTTGCGTATGAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-311s1c1
Sequence:CCGGGCTAGAAGATGATGTGTTCCACTCGAGTGGAACACATCATCTTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_138313.2-687s1c1
Sequence:CCGGGCCAGAAAGCTTCAGTGTATTCTCGAGAATACACTGAAGCTTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks