EMAIL THIS PAGE TO A FRIEND

BMI1

BMI1 polycomb ring finger oncogene

Synonyms: FLVI2/BMI1 PCGF4 RNF51
UniProtKB ID: P35226, Q16030, Q5T8Z3, Q96F37
Gene ID:
Mouse(12151) Bmi1 polycomb ring finger oncogene
Rat(307151) Bmi1 polycomb ring finger oncogene
naked mole-rat(101705973) BMI1 polycomb ring finger oncogene
Domestic Rabbit(100009347) BMI1 polycomb ring finger oncogene
chicken(493647) BMI1 polycomb ring finger oncogene
cow(510666) BMI1 polycomb ring finger oncogene
domestic cat(554342) BMI1 polycomb ring finger oncogene
dog(487097) BMI1 polycomb ring finger oncogene
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS3755 Anti-BMI-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
B6687 Anti-BMI1 (136-150) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B6812 Anti-BMI1 (301-315) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4200034 Anti-BMI1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4200033 Anti-BMI1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA030472 Anti-BMI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB2106309 Anti-BMI1 antibody produced in rabbit affinity isolated antibody human, mouse, horse, guinea pig, rabbit
ELISA, western blot pricing
HPA030471 Anti-BMI1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
AV34213 Anti-PCGF4 antibody produced in rabbit affinity isolated antibody human, mouse, canine, guinea pig, rabbit, horse, bovine, rat
western blot pricing
SAB5300333 Monoclonal Anti-BMI1 antibody produced in mouse clone 3E3, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
WH0000648M2 Monoclonal Anti-PCGF4 antibody produced in mouse clone 4E10-1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0208 Rabbit anti-BMI1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rabbit, guinea pig, mouse, chicken, rat, toad, bovine, horse, human, primate, dog, pig
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005180 Rosetta Predictions human pricing
NM_001107368 Rosetta Predictions rat pricing
NM_007552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175764 predicted 519
2 SASI_Hs01_00175765 predicted 1577
3 SASI_Hs01_00175766 predicted 569
4 SASI_Hs02_00339127 predicted 650
5 SASI_Hs01_00175768 predicted 1112
6 SASI_Hs01_00175769 predicted 916
7 SASI_Hs01_00175770 predicted 704
8 SASI_Hs01_00175772 predicted 1007
9 SASI_Hs01_00175773 predicted 559
10 SASI_Hs02_00339128 predicted 998
11 SASI_Hs01_00175767 predicted 964
12 SASI_Hs01_00175771 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228135 predicted 809
2 SASI_Rn02_00228136 predicted 506
3 SASI_Rn02_00228137 predicted 647
4 SASI_Rn02_00228138 predicted 219
5 SASI_Rn02_00228139 predicted 631
6 SASI_Rn02_00228140 predicted 205
7 SASI_Rn02_00228141 predicted 828
8 SASI_Rn02_00228142 predicted 720
9 SASI_Rn02_00228143 predicted 754
10 SASI_Rn02_00228144 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090838 predicted 1497
2 SASI_Mm02_00311913 predicted 838
3 SASI_Mm01_00090839 predicted 1324
4 SASI_Mm01_00090841 predicted 1051
5 SASI_Mm01_00090842 predicted 1013
6 SASI_Mm01_00090843 predicted 710
7 SASI_Mm02_00311914 predicted 1026
8 SASI_Mm01_00090844 predicted 603
9 SASI_Mm02_00311915 predicted 909
10 SASI_Mm02_00311916 predicted 961
11 SASI_Mm01_00090836 predicted 512
12 SASI_Mm01_00090837 predicted 491
13 SASI_Mm01_00090840 predicted 925
14 SASI_Mm01_00090845 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005180
VALIDATED
BMI1 MISSION shRNA Bacterial Glycerol Stock
BMI1 polycomb ring finger oncogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005180.5-1134s1c1
Sequence:CCGGCCTACATTTATACCTGGAGAACTCGAGTTCTCCAGGTATAAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-693s1c1
Sequence:CCGGCCAGACCACTACTGAATATAACTCGAGTTATATTCAGTAGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-938s1c1
Sequence:CCGGCGGAAAGTAAACAAAGACAAACTCGAGTTTGTCTTTGTTTACTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-922s1c1
Sequence:CCGGCCAGAACAGATTGGATCGGAACTCGAGTTCCGATCCAATCTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-1061s1c1
Sequence:CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGGAAAGTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-581s21c1
Sequence:CCGGATTGATGCCACAACCATAATACTCGAGTATTATGGTTGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-928s21c1
Sequence:GTACCGGCAGATTGGATCGGAAAGTAAACTCGAGTTTACTTTCCGATCCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005180.5-1645s21c1
Sequence:GTACCGGATACTCCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-1096s21c1
Sequence:CCGGGGAACCTTTAAAGGATTATTACTCGAGTAATAATCCTTTAAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005180
VALIDATED
BMI1 MISSION shRNA shRNA Plasmid DNA
BMI1 polycomb ring finger oncogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005180.5-1134s1c1
Sequence:CCGGCCTACATTTATACCTGGAGAACTCGAGTTCTCCAGGTATAAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-693s1c1
Sequence:CCGGCCAGACCACTACTGAATATAACTCGAGTTATATTCAGTAGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-938s1c1
Sequence:CCGGCGGAAAGTAAACAAAGACAAACTCGAGTTTGTCTTTGTTTACTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-922s1c1
Sequence:CCGGCCAGAACAGATTGGATCGGAACTCGAGTTCCGATCCAATCTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-1061s1c1
Sequence:CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGGAAAGTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-581s21c1
Sequence:CCGGATTGATGCCACAACCATAATACTCGAGTATTATGGTTGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-928s21c1
Sequence:GTACCGGCAGATTGGATCGGAAAGTAAACTCGAGTTTACTTTCCGATCCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005180.5-1645s21c1
Sequence:GTACCGGATACTCCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-1096s21c1
Sequence:CCGGGGAACCTTTAAAGGATTATTACTCGAGTAATAATCCTTTAAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005180
VALIDATED
BMI1 MISSION shRNA Lentiviral Transduction Particles
BMI1 polycomb ring finger oncogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005180.5-1134s1c1
Sequence:CCGGCCTACATTTATACCTGGAGAACTCGAGTTCTCCAGGTATAAATGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-693s1c1
Sequence:CCGGCCAGACCACTACTGAATATAACTCGAGTTATATTCAGTAGTGGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-938s1c1
Sequence:CCGGCGGAAAGTAAACAAAGACAAACTCGAGTTTGTCTTTGTTTACTTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-922s1c1
Sequence:CCGGCCAGAACAGATTGGATCGGAACTCGAGTTCCGATCCAATCTGTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005180.5-1061s1c1
Sequence:CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGGAAAGTATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-581s21c1
Sequence:CCGGATTGATGCCACAACCATAATACTCGAGTATTATGGTTGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-928s21c1
Sequence:GTACCGGCAGATTGGATCGGAAAGTAAACTCGAGTTTACTTTCCGATCCAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005180.5-1645s21c1
Sequence:GTACCGGATACTCCTATGGACGTTAATTCTCGAGAATTAACGTCCATAGGAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005180.5-1096s21c1
Sequence:CCGGGGAACCTTTAAAGGATTATTACTCGAGTAATAATCCTTTAAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007552
VALIDATED
BMI1 MISSION shRNA Bacterial Glycerol Stock
BMI1 polycomb ring finger oncogene
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-422s1c1
Sequence:CCGGGCAGATTGGATCGGAAAGTAACTCGAGTTACTTTCCGATCCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-198s1c1
Sequence:CCGGCCTGAACATAAGGTCAGATAACTCGAGTTATCTGACCTTATGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-146s1c1
Sequence:CCGGCCAGCAAGTATTGTCCTATTTCTCGAGAAATAGGACAATACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-546s1c1
Sequence:CCGGCATACCCAATCATTTCCAGATCTCGAGATCTGGAAATGATTGGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-454s1c1
Sequence:CCGGCCTAAGGAAGAGGTGAATGATCTCGAGATCATTCACCTCTTCCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-826s21c1
Sequence:CCGGGATGAGGAGAAGAGGATTATACTCGAGTATAATCCTCTTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-2020s21c1
Sequence:CCGGAGCGGGTACTACCGTTTATTTCTCGAGAAATAAACGGTAGTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-1082s21c1
Sequence:CCGGTAATGGACATTGCCTACATTTCTCGAGAAATGTAGGCAATGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-618s21c1
Sequence:CCGGCAGCAAGTATTGTCCTATTTGCTCGAGCAAATAGGACAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-547s21c1
Sequence:CCGGATTGATGCCACTACCATAATACTCGAGTATTATGGTAGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007552
VALIDATED
BMI1 MISSION shRNA shRNA Plasmid DNA
BMI1 polycomb ring finger oncogene
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-422s1c1
Sequence:CCGGGCAGATTGGATCGGAAAGTAACTCGAGTTACTTTCCGATCCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-198s1c1
Sequence:CCGGCCTGAACATAAGGTCAGATAACTCGAGTTATCTGACCTTATGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-146s1c1
Sequence:CCGGCCAGCAAGTATTGTCCTATTTCTCGAGAAATAGGACAATACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-546s1c1
Sequence:CCGGCATACCCAATCATTTCCAGATCTCGAGATCTGGAAATGATTGGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-454s1c1
Sequence:CCGGCCTAAGGAAGAGGTGAATGATCTCGAGATCATTCACCTCTTCCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-826s21c1
Sequence:CCGGGATGAGGAGAAGAGGATTATACTCGAGTATAATCCTCTTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-2020s21c1
Sequence:CCGGAGCGGGTACTACCGTTTATTTCTCGAGAAATAAACGGTAGTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-1082s21c1
Sequence:CCGGTAATGGACATTGCCTACATTTCTCGAGAAATGTAGGCAATGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-618s21c1
Sequence:CCGGCAGCAAGTATTGTCCTATTTGCTCGAGCAAATAGGACAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-547s21c1
Sequence:CCGGATTGATGCCACTACCATAATACTCGAGTATTATGGTAGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007552
VALIDATED
BMI1 MISSION shRNA Lentiviral Transduction Particles
BMI1 polycomb ring finger oncogene
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-422s1c1
Sequence:CCGGGCAGATTGGATCGGAAAGTAACTCGAGTTACTTTCCGATCCAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-198s1c1
Sequence:CCGGCCTGAACATAAGGTCAGATAACTCGAGTTATCTGACCTTATGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-146s1c1
Sequence:CCGGCCAGCAAGTATTGTCCTATTTCTCGAGAAATAGGACAATACTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007552.1-546s1c1
Sequence:CCGGCATACCCAATCATTTCCAGATCTCGAGATCTGGAAATGATTGGGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007552.1-454s1c1
Sequence:CCGGCCTAAGGAAGAGGTGAATGATCTCGAGATCATTCACCTCTTCCTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-826s21c1
Sequence:CCGGGATGAGGAGAAGAGGATTATACTCGAGTATAATCCTCTTCTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-2020s21c1
Sequence:CCGGAGCGGGTACTACCGTTTATTTCTCGAGAAATAAACGGTAGTACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-1082s21c1
Sequence:CCGGTAATGGACATTGCCTACATTTCTCGAGAAATGTAGGCAATGTCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-618s21c1
Sequence:CCGGCAGCAAGTATTGTCCTATTTGCTCGAGCAAATAGGACAATACTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007552.4-547s21c1
Sequence:CCGGATTGATGCCACTACCATAATACTCGAGTATTATGGTAGTGGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks