EMAIL THIS PAGE TO A FRIEND

BMP10

bone morphogenetic protein 10

59 Gene Product Result for
UniProtKB ID: O95393, Q53R17, Q6NTE0
Gene ID:
Human(27302) Summary: The protein encoded by this gene is a member of the TGF-beta family of growth factors. Data suggest that the similar protein in mouse plays an important role in trabeculation of the embryonic heart. In human, this protein may signal through receptor serine/threonine kinases. [provided by RefSeq, Jul 2008]
Mouse(12154) bone morphogenetic protein 10
Rat(500245) bone morphogenetic protein 10
Zebrafish(562533) bone morphogenetic protein 10
dog(481408) bone morphogenetic protein 10
chicken(395177) bone morphogenetic protein 10
domestic cat(101092676) bone morphogenetic protein 10
cow(538874) bone morphogenetic protein 10
Horse(100050890) bone morphogenetic protein 10
domestic guinea pig(100729069) bone morphogenetic protein 10
naked mole-rat(101702541) bone morphogenetic protein 10
sheep(101109160) bone morphogenetic protein 10
Domestic Rabbit(100357896) bone morphogenetic protein 10
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020891 MISSION® esiRNA esiRNA human BMP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014482 Rosetta Predictions human pricing
NM_001031824 Rosetta Predictions rat pricing
NM_009756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181782 predicted 404
2 SASI_Hs01_00181783 predicted 1150
3 SASI_Hs01_00181784 predicted 1205
4 SASI_Hs01_00181785 predicted 892
5 SASI_Hs01_00181786 predicted 407
6 SASI_Hs01_00181787 predicted 1065
7 SASI_Hs01_00181788 predicted 1076
8 SASI_Hs01_00181789 predicted 873
9 SASI_Hs01_00181790 predicted 1199
10 SASI_Hs01_00181791 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054112 predicted 225
2 SASI_Rn01_00054113 predicted 308
3 SASI_Rn01_00054114 predicted 366
4 SASI_Rn01_00054115 predicted 890
5 SASI_Rn01_00054117 predicted 744
6 SASI_Rn02_00203612 predicted 446
7 SASI_Rn01_00054119 predicted 989
8 SASI_Rn01_00054121 predicted 716
9 SASI_Rn02_00203613 predicted 340
10 SASI_Rn02_00203614 predicted 1021
11 SASI_Rn01_00054116 predicted 970
12 SASI_Rn01_00054118 predicted 561
13 SASI_Rn01_00054120 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096768 predicted 582
2 SASI_Mm01_00096769 predicted 1021
3 SASI_Mm01_00096770 predicted 393
4 SASI_Mm01_00096772 predicted 993
5 SASI_Mm01_00096777 predicted 236
6 SASI_Mm02_00316942 predicted 485
7 SASI_Mm02_00316943 predicted 200
8 SASI_Mm02_00316944 predicted 205
9 SASI_Mm02_00316945 predicted 343
10 SASI_Mm02_00316946 predicted 590
11 SASI_Mm01_00096771 predicted 581
12 SASI_Mm01_00096773 predicted 460
13 SASI_Mm01_00096774 predicted 323
14 SASI_Mm01_00096775 predicted 230
15 SASI_Mm01_00096776 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014482
BMP10 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-325s1c1
Sequence:CCGGCAGAGCATGAAGGATGAGTTTCTCGAGAAACTCATCCTTCATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-893s1c1
Sequence:CCGGCCCAGAATAAGCATAACCCTTCTCGAGAAGGGTTATGCTTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-622s1c1
Sequence:CCGGCGTATGATATACGATGGAGTACTCGAGTACTCCATCGTATATCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-871s1c1
Sequence:CCGGCGGCTAGAAATAGATACCAGTCTCGAGACTGGTATCTATTTCTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014482.1-1345s1c1
Sequence:CCGGCCCATCTCCATCCTCTATTTACTCGAGTAAATAGAGGATGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-293s21c1
Sequence:CCGGAGCAAGACGGTGTCGACTTTACTCGAGTAAAGTCGACACCGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1373s21c1
Sequence:CCGGGCGTCGTCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1255s21c1
Sequence:CCGGCCCACAAAGCATGCAATTATCCTCGAGGATAATTGCATGCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-582s21c1
Sequence:CCGGCATGGCTGAACTTAGGCTATACTCGAGTATAGCCTAAGTTCAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014482
BMP10 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-325s1c1
Sequence:CCGGCAGAGCATGAAGGATGAGTTTCTCGAGAAACTCATCCTTCATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-893s1c1
Sequence:CCGGCCCAGAATAAGCATAACCCTTCTCGAGAAGGGTTATGCTTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-622s1c1
Sequence:CCGGCGTATGATATACGATGGAGTACTCGAGTACTCCATCGTATATCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-871s1c1
Sequence:CCGGCGGCTAGAAATAGATACCAGTCTCGAGACTGGTATCTATTTCTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014482.1-1345s1c1
Sequence:CCGGCCCATCTCCATCCTCTATTTACTCGAGTAAATAGAGGATGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-293s21c1
Sequence:CCGGAGCAAGACGGTGTCGACTTTACTCGAGTAAAGTCGACACCGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1373s21c1
Sequence:CCGGGCGTCGTCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1255s21c1
Sequence:CCGGCCCACAAAGCATGCAATTATCCTCGAGGATAATTGCATGCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-582s21c1
Sequence:CCGGCATGGCTGAACTTAGGCTATACTCGAGTATAGCCTAAGTTCAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014482
BMP10 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-325s1c1
Sequence:CCGGCAGAGCATGAAGGATGAGTTTCTCGAGAAACTCATCCTTCATGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-893s1c1
Sequence:CCGGCCCAGAATAAGCATAACCCTTCTCGAGAAGGGTTATGCTTATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-622s1c1
Sequence:CCGGCGTATGATATACGATGGAGTACTCGAGTACTCCATCGTATATCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014482.1-871s1c1
Sequence:CCGGCGGCTAGAAATAGATACCAGTCTCGAGACTGGTATCTATTTCTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014482.1-1345s1c1
Sequence:CCGGCCCATCTCCATCCTCTATTTACTCGAGTAAATAGAGGATGGAGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-293s21c1
Sequence:CCGGAGCAAGACGGTGTCGACTTTACTCGAGTAAAGTCGACACCGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1373s21c1
Sequence:CCGGGCGTCGTCACCTACAAGTTTACTCGAGTAAACTTGTAGGTGACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-1255s21c1
Sequence:CCGGCCCACAAAGCATGCAATTATCCTCGAGGATAATTGCATGCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014482.1-582s21c1
Sequence:CCGGCATGGCTGAACTTAGGCTATACTCGAGTATAGCCTAAGTTCAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009756
BMP10 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c2
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-966s1c1
Sequence:CCGGCCCACTATACATCGACTTCAACTCGAGTTGAAGTCGATGTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-255s1c1
Sequence:CCGGGCTGGAGCTCTACAACAAATTCTCGAGAATTTGTTGTAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c1
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-366s1c1
Sequence:CCGGCCGGAAATATCCTCTCCTCTTCTCGAGAAGAGGAGAGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-135s1c1
Sequence:CCGGGCAAGATGGTATTGACTTCAACTCGAGTTGAAGTCAATACCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009756
BMP10 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c2
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-966s1c1
Sequence:CCGGCCCACTATACATCGACTTCAACTCGAGTTGAAGTCGATGTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-255s1c1
Sequence:CCGGGCTGGAGCTCTACAACAAATTCTCGAGAATTTGTTGTAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c1
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-366s1c1
Sequence:CCGGCCGGAAATATCCTCTCCTCTTCTCGAGAAGAGGAGAGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-135s1c1
Sequence:CCGGGCAAGATGGTATTGACTTCAACTCGAGTTGAAGTCAATACCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009756
BMP10 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c2
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-966s1c1
Sequence:CCGGCCCACTATACATCGACTTCAACTCGAGTTGAAGTCGATGTATAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-255s1c1
Sequence:CCGGGCTGGAGCTCTACAACAAATTCTCGAGAATTTGTTGTAGAGCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-662s1c1
Sequence:CCGGTCCACATAGAAAGCAGACAAACTCGAGTTTGTCTGCTTTCTATGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-366s1c1
Sequence:CCGGCCGGAAATATCCTCTCCTCTTCTCGAGAAGAGGAGAGGATATTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009756.1-135s1c1
Sequence:CCGGGCAAGATGGTATTGACTTCAACTCGAGTTGAAGTCAATACCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks