EMAIL THIS PAGE TO A FRIEND

BMP15

bone morphogenetic protein 15

47 Gene Product Result for
Synonyms: GDF9B ODG2 POF4
UniProtKB ID: O95972, Q17RM6, Q5JST1, Q9UMS1
Gene ID:
Human(9210) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. The transforming growth factor-beta superfamily includes large families of growth and differentiation factors. It is thought that this protein may be involved in oocyte maturation and follicular development as a homodimer or by forming heterodimers with a related protein, Gdf9. Defects in this gene are the cause of ovarian dysgenesis 2.[provided by RefSeq, Sep 2009]
Mouse(12155) bone morphogenetic protein 15
Rat(59302) bone morphogenetic protein 15
Goat(100861233) bone morphogenetic protein 15
sheep(100141303) bone morphogenetic protein 15
Domestic Rabbit(100355411) bone morphogenetic protein 15
Domestic Rabbit(100301545) bone morphogenetic protein 15
domestic guinea pig(100732890) bone morphogenetic protein 15
Zebrafish(334183) bone morphogenetic protein 15
dog(491885) bone morphogenetic protein 15
chicken(428697) bone morphogenetic protein 15
cow(353351) bone morphogenetic protein 15
Horse(100052461) bone morphogenetic protein 15
domestic cat(100306941) bone morphogenetic protein 15
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034221 MISSION® esiRNA esiRNA human BMP15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005448 Rosetta Predictions human pricing
NM_021670 Rosetta Predictions rat pricing
NM_009757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236401 predicted 317
2 SASI_Hs01_00236402 predicted 418
3 SASI_Hs01_00236403 predicted 530
4 SASI_Hs01_00236404 predicted 536
5 SASI_Hs01_00236405 predicted 747
6 SASI_Hs01_00236406 predicted 373
7 SASI_Hs01_00236407 predicted 473
8 SASI_Hs01_00236408 predicted 570
9 SASI_Hs01_00236409 predicted 420
10 SASI_Hs01_00236410 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066257 predicted 982
2 SASI_Rn01_00066258 predicted 1080
3 SASI_Rn01_00066259 predicted 581
4 SASI_Rn01_00066260 predicted 356
5 SASI_Rn01_00066261 predicted 1217
6 SASI_Rn02_00262682 predicted 777
7 SASI_Rn01_00066262 predicted 783
8 SASI_Rn01_00066263 predicted 1205
9 SASI_Rn01_00066265 predicted 991
10 SASI_Rn01_00066266 predicted 1102
11 SASI_Rn01_00066264 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047460 predicted 1197
2 SASI_Mm01_00047461 predicted 1551
3 SASI_Mm01_00047462 predicted 1603
4 SASI_Mm01_00047463 predicted 891
5 SASI_Mm01_00047464 predicted 1504
6 SASI_Mm01_00047465 predicted 1107
7 SASI_Mm01_00047466 predicted 701
8 SASI_Mm01_00047467 predicted 1314
9 SASI_Mm01_00047468 predicted 564
10 SASI_Mm01_00047469 predicted 813
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005448
BMP15 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-737s21c1
Sequence:CCGGGCCTTCTTGTTACTCTATTTCCTCGAGGAAATAGAGTAACAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-104s21c1
Sequence:CCGGATGGAACACAGGGCCCAAATGCTCGAGCATTTGGGCCCTGTGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-1029s21c1
Sequence:CCGGTACTACGCGATGGTCTCAATTCTCGAGAATTGAGACCATCGCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-537s1c1
Sequence:CCGGCGCTTGGAAAGAGATGGATATCTCGAGATATCCATCTCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-1010s1c1
Sequence:CCGGACGCCATTATTCAGAACCTTACTCGAGTAAGGTTCTGAATAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-879s1c1
Sequence:CCGGCCACCCTTTCCAAATCAGCTTCTCGAGAAGCTGATTTGGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-497s1c1
Sequence:CCGGCCTCAGAAGGAGATTCCTCAACTCGAGTTGAGGAATCTCCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-373s1c1
Sequence:CCGGCGAGGACTATACCAACTAGTTCTCGAGAACTAGTTGGTATAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005448
BMP15 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-737s21c1
Sequence:CCGGGCCTTCTTGTTACTCTATTTCCTCGAGGAAATAGAGTAACAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-104s21c1
Sequence:CCGGATGGAACACAGGGCCCAAATGCTCGAGCATTTGGGCCCTGTGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-1029s21c1
Sequence:CCGGTACTACGCGATGGTCTCAATTCTCGAGAATTGAGACCATCGCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-537s1c1
Sequence:CCGGCGCTTGGAAAGAGATGGATATCTCGAGATATCCATCTCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-1010s1c1
Sequence:CCGGACGCCATTATTCAGAACCTTACTCGAGTAAGGTTCTGAATAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-879s1c1
Sequence:CCGGCCACCCTTTCCAAATCAGCTTCTCGAGAAGCTGATTTGGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-497s1c1
Sequence:CCGGCCTCAGAAGGAGATTCCTCAACTCGAGTTGAGGAATCTCCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-373s1c1
Sequence:CCGGCGAGGACTATACCAACTAGTTCTCGAGAACTAGTTGGTATAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005448
BMP15 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-737s21c1
Sequence:CCGGGCCTTCTTGTTACTCTATTTCCTCGAGGAAATAGAGTAACAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-104s21c1
Sequence:CCGGATGGAACACAGGGCCCAAATGCTCGAGCATTTGGGCCCTGTGTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005448.2-1029s21c1
Sequence:CCGGTACTACGCGATGGTCTCAATTCTCGAGAATTGAGACCATCGCGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-537s1c1
Sequence:CCGGCGCTTGGAAAGAGATGGATATCTCGAGATATCCATCTCTTTCCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-1010s1c1
Sequence:CCGGACGCCATTATTCAGAACCTTACTCGAGTAAGGTTCTGAATAATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-879s1c1
Sequence:CCGGCCACCCTTTCCAAATCAGCTTCTCGAGAAGCTGATTTGGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-497s1c1
Sequence:CCGGCCTCAGAAGGAGATTCCTCAACTCGAGTTGAGGAATCTCCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005448.1-373s1c1
Sequence:CCGGCGAGGACTATACCAACTAGTTCTCGAGAACTAGTTGGTATAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009757
BMP15 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1305s1c1
Sequence:CCGGCCCAAATTACTGTAAAGGAATCTCGAGATTCCTTTACAGTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-763s1c1
Sequence:CCGGCGCCATCAACTTCATCTAGTTCTCGAGAACTAGATGAAGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1236s1c1
Sequence:CCGGCCATCCTTACAAGGTCAGCTTCTCGAGAAGCTGACCTTGTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-889s1c1
Sequence:CCGGGCCTGGACAGAGATAGATATTCTCGAGAATATCTATCTCTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1447s1c1
Sequence:CCGGCCTATGAGCATCCTCCTGATTCTCGAGAATCAGGAGGATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009757
BMP15 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1305s1c1
Sequence:CCGGCCCAAATTACTGTAAAGGAATCTCGAGATTCCTTTACAGTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-763s1c1
Sequence:CCGGCGCCATCAACTTCATCTAGTTCTCGAGAACTAGATGAAGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1236s1c1
Sequence:CCGGCCATCCTTACAAGGTCAGCTTCTCGAGAAGCTGACCTTGTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-889s1c1
Sequence:CCGGGCCTGGACAGAGATAGATATTCTCGAGAATATCTATCTCTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1447s1c1
Sequence:CCGGCCTATGAGCATCCTCCTGATTCTCGAGAATCAGGAGGATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009757
BMP15 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1305s1c1
Sequence:CCGGCCCAAATTACTGTAAAGGAATCTCGAGATTCCTTTACAGTAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-763s1c1
Sequence:CCGGCGCCATCAACTTCATCTAGTTCTCGAGAACTAGATGAAGTTGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1236s1c1
Sequence:CCGGCCATCCTTACAAGGTCAGCTTCTCGAGAAGCTGACCTTGTAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-889s1c1
Sequence:CCGGGCCTGGACAGAGATAGATATTCTCGAGAATATCTATCTCTGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009757.3-1447s1c1
Sequence:CCGGCCTATGAGCATCCTCCTGATTCTCGAGAATCAGGAGGATGCTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks