EMAIL THIS PAGE TO A FRIEND

BMP1

bone morphogenetic protein 1

Synonyms: OI13 PCOLC PCP PCP2 TLD
Gene ID:
Human(649) Summary: This gene encodes a protein that is capable of inducing formation of cartilage in vivo. Although other bone morphogenetic proteins are members of the TGF-beta superfamily, this gene encodes a protein that is not closely related to other known growth factors. This gene is expressed as alternatively spliced variants that share an N-terminal protease domain but differ in their C-terminal region. [provided by RefSeq, Aug 2008]
Mouse(12153) bone morphogenetic protein 1
Rat(83470) bone morphogenetic protein 1
sheep(101122334) bone morphogenetic protein 1
naked mole-rat(101713810) bone morphogenetic protein 1
domestic guinea pig(100729039) bone morphogenetic protein 1
chicken(414883) bone morphogenetic protein 1
cow(281024) bone morphogenetic protein 1
cow(510360) bone morphogenetic protein 1
Horse(100056914) bone morphogenetic protein 1
domestic cat(101093350) bone morphogenetic protein 1
dog(486127) bone morphogenetic protein 1
Gene Class: Cytokines_and_Chemokines
263 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1288 Human BMP-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001199 Rosetta Predictions human pricing
NM_006128 Rosetta Predictions human pricing
NM_006129 Rosetta Predictions human pricing
XM_001070483 Rosetta Predictions rat pricing
XM_001070524 Rosetta Predictions rat pricing
XM_001075543 Rosetta Predictions rat pricing
XM_573814 Rosetta Predictions rat pricing
NM_009755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331339 predicted 726
2 SASI_Hs01_00230727 predicted 1342
3 SASI_Hs01_00230728 predicted 1357
4 SASI_Hs01_00230729 predicted 812
5 SASI_Hs01_00230730 predicted 259
6 SASI_Hs01_00230731 predicted 1384
7 SASI_Hs01_00230732 predicted 1370
8 SASI_Hs01_00230733 predicted 544
9 SASI_Hs01_00230734 predicted 863
10 SASI_Hs01_00230735 predicted 1384
11 SASI_Hs01_00230736 predicted 1556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340960 predicted 727
2 SASI_Hs01_00163245 predicted 1347
3 SASI_Hs01_00163246 predicted 1358
4 SASI_Hs01_00163247 predicted 808
5 SASI_Hs01_00163248 predicted 261
6 SASI_Hs01_00163249 predicted 1381
7 SASI_Hs01_00163250 predicted 1369
8 SASI_Hs01_00163251 predicted 548
9 SASI_Hs01_00163252 predicted 860
10 SASI_Hs01_00163253 predicted 1381
11 SASI_Hs01_00163254 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340961 predicted 695
2 SASI_Hs01_00226530 predicted 1316
3 SASI_Hs01_00226531 predicted 1328
4 SASI_Hs01_00226532 predicted 782
5 SASI_Hs01_00226533 predicted 230
6 SASI_Hs01_00226534 predicted 1350
7 SASI_Hs01_00226535 predicted 1342
8 SASI_Hs01_00226536 predicted 516
9 SASI_Hs01_00226537 predicted 830
10 SASI_Hs01_00226538 predicted 1347
11 SASI_Hs01_00226539 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331808 predicted 2738
2 SASI_Rn02_00331809 predicted 2206
3 SASI_Rn02_00331810 predicted 2993
4 SASI_Rn02_00331811 predicted 2007
5 SASI_Rn02_00331812 predicted 1194
6 SASI_Rn02_00331813 predicted 1465
7 SASI_Rn02_00331814 predicted 1529
8 SASI_Rn02_00331815 predicted 1184
9 SASI_Rn02_00331816 predicted 2201
10 SASI_Rn02_00331817 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331935 predicted 3585
2 SASI_Rn02_00331936 predicted 2206
3 SASI_Rn02_00331937 predicted 2986
4 SASI_Rn02_00331938 predicted 1193
5 SASI_Rn02_00331939 predicted 1466
6 SASI_Rn02_00331940 predicted 1531
7 SASI_Rn02_00331941 predicted 1182
8 SASI_Rn02_00331942 predicted 2196
9 SASI_Rn02_00331943 predicted 2920
10 SASI_Rn02_00331944 predicted 2596
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350155 predicted 2740
2 SASI_Rn02_00350156 predicted 2205
3 SASI_Rn02_00350157 predicted 2991
4 SASI_Rn02_00350158 predicted 2009
5 SASI_Rn02_00350159 predicted 1198
6 SASI_Rn02_00350160 predicted 1462
7 SASI_Rn02_00350161 predicted 1532
8 SASI_Rn02_00350162 predicted 1188
9 SASI_Rn02_00350163 predicted 2200
10 SASI_Rn02_00350164 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400854 predicted 3577
2 SASI_Rn02_00400855 predicted 2209
3 SASI_Rn02_00400856 predicted 2988
4 SASI_Rn02_00400857 predicted 1194
5 SASI_Rn02_00400858 predicted 1464
6 SASI_Rn02_00400859 predicted 1535
7 SASI_Rn02_00400860 predicted 1188
8 SASI_Rn02_00400861 predicted 2200
9 SASI_Rn02_00400862 predicted 2925
10 SASI_Rn02_00400863 predicted 2596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316940 predicted 1491
2 SASI_Mm02_00316941 predicted 1204
3 SASI_Mm01_00149417 predicted 2470
4 SASI_Mm01_00149418 predicted 1503
5 SASI_Mm01_00149419 predicted 678
6 SASI_Mm01_00149420 predicted 1015
7 SASI_Mm01_00149422 predicted 2516
8 SASI_Mm01_00149423 predicted 1696
9 SASI_Mm01_00149424 predicted 2918
10 SASI_Mm01_00149425 predicted 2132
11 SASI_Mm01_00149421 predicted 2217
12 SASI_Mm01_00149426 predicted 3168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001199
VALIDATED
BMP1 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2565s21c1
Sequence:CCGGGACAGAACTGGTGCTCTCTTCCTCGAGGAAGAGAGCACCAGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-752s21c1
Sequence:CCGGACTGACGAGGACAGCTATATTCTCGAGAATATAGCTGTCCTCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1701s21c1
Sequence:CCGGACAGCTGTGCCTACGACTATCCTCGAGGATAGTCGTAGGCACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2473s21c1
Sequence:CCGGGAACCTCACCTTGGACGGAATCTCGAGATTCCGTCCAAGGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1040s21c1
Sequence:CCGGTTCGACAGCATCATGCATTACCTCGAGGTAATGCATGATGCTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-2051s1c1
Sequence:CCGGCACCTCCCAGTACAACAACATCTCGAGATGTTGTTGTACTGGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1628s1c1
Sequence:CCGGGTCCATTAACAAAGCGGGCTTCTCGAGAAGCCCGCTTTGTTAATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-1550s1c1
Sequence:CCGGGCGCTACTGTGGCTATGAGAACTCGAGTTCTCATAGCCACAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1372s1c1
Sequence:CCGGCGCCCAACTACCCAGACGATTCTCGAGAATCGTCTGGGTAGTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-264s1c1
Sequence:CCGGGCTCGTAAGTCCTCCATCAAACTCGAGTTTGATGGAGGACTTACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001199
VALIDATED
BMP1 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2565s21c1
Sequence:CCGGGACAGAACTGGTGCTCTCTTCCTCGAGGAAGAGAGCACCAGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-752s21c1
Sequence:CCGGACTGACGAGGACAGCTATATTCTCGAGAATATAGCTGTCCTCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1701s21c1
Sequence:CCGGACAGCTGTGCCTACGACTATCCTCGAGGATAGTCGTAGGCACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2473s21c1
Sequence:CCGGGAACCTCACCTTGGACGGAATCTCGAGATTCCGTCCAAGGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1040s21c1
Sequence:CCGGTTCGACAGCATCATGCATTACCTCGAGGTAATGCATGATGCTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-2051s1c1
Sequence:CCGGCACCTCCCAGTACAACAACATCTCGAGATGTTGTTGTACTGGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1628s1c1
Sequence:CCGGGTCCATTAACAAAGCGGGCTTCTCGAGAAGCCCGCTTTGTTAATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-1550s1c1
Sequence:CCGGGCGCTACTGTGGCTATGAGAACTCGAGTTCTCATAGCCACAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1372s1c1
Sequence:CCGGCGCCCAACTACCCAGACGATTCTCGAGAATCGTCTGGGTAGTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-264s1c1
Sequence:CCGGGCTCGTAAGTCCTCCATCAAACTCGAGTTTGATGGAGGACTTACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001199
VALIDATED
BMP1 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2565s21c1
Sequence:CCGGGACAGAACTGGTGCTCTCTTCCTCGAGGAAGAGAGCACCAGTTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-752s21c1
Sequence:CCGGACTGACGAGGACAGCTATATTCTCGAGAATATAGCTGTCCTCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1701s21c1
Sequence:CCGGACAGCTGTGCCTACGACTATCCTCGAGGATAGTCGTAGGCACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001199.2-2473s21c1
Sequence:CCGGGAACCTCACCTTGGACGGAATCTCGAGATTCCGTCCAAGGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001199.2-1040s21c1
Sequence:CCGGTTCGACAGCATCATGCATTACCTCGAGGTAATGCATGATGCTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-2051s1c1
Sequence:CCGGCACCTCCCAGTACAACAACATCTCGAGATGTTGTTGTACTGGGAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1628s1c1
Sequence:CCGGGTCCATTAACAAAGCGGGCTTCTCGAGAAGCCCGCTTTGTTAATGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001199.x-1550s1c1
Sequence:CCGGGCGCTACTGTGGCTATGAGAACTCGAGTTCTCATAGCCACAGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-1372s1c1
Sequence:CCGGCGCCCAACTACCCAGACGATTCTCGAGAATCGTCTGGGTAGTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001199.x-264s1c1
Sequence:CCGGGCTCGTAAGTCCTCCATCAAACTCGAGTTTGATGGAGGACTTACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009755
BMP1 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2374s21c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-572s21c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-1016s21c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2044s21c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009755.2-3428s21c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009755.2-3428s1c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-1016s1c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2374s1c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2044s1c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-572s1c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009755
BMP1 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2374s21c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-572s21c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-1016s21c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2044s21c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009755.2-3428s21c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009755.2-3428s1c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-1016s1c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2374s1c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2044s1c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-572s1c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009755
BMP1 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2374s21c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-572s21c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-1016s21c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009755.2-2044s21c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009755.2-3428s21c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009755.2-3428s1c1
Sequence:CCGGGCCGTCTTTACACACTGTATTCTCGAGAATACAGTGTGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-1016s1c1
Sequence:CCGGGACACCATTGTTCCCAAGTATCTCGAGATACTTGGGAACAATGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2374s1c1
Sequence:CCGGCGACAACAAACATGACTGTAACTCGAGTTACAGTCATGTTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-2044s1c1
Sequence:CCGGGTACCGTATCTCCCTGCAATTCTCGAGAATTGCAGGGAGATACGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009755.2-572s1c1
Sequence:CCGGCCGTTTGTGATTGGAGGGAATCTCGAGATTCCCTCCAATCACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks