EMAIL THIS PAGE TO A FRIEND

BMP2

bone morphogenetic protein 2

132 Gene Product Result for
Synonyms: BDA2 BMP2A
UniProtKB ID: P12643
Gene ID:
Human(650) Summary: The protein encoded by this gene belongs to the transforming growth factor-beta (TGFB) superfamily. The encoded protein acts as a disulfide-linked homodimer and induces bone and cartilage formation. [provided by RefSeq, Jul 2008]
Mouse(12156) bone morphogenetic protein 2
Rat(29373) bone morphogenetic protein 2
chicken(378779) bone morphogenetic protein 2
dog(477162) bone morphogenetic protein 2
Horse(100051701) bone morphogenetic protein 2
cow(615037) bone morphogenetic protein 2
domestic cat(100301987) bone morphogenetic protein 2
domestic guinea pig(100732974) bone morphogenetic protein 2
naked mole-rat(101723419) bone morphogenetic protein 2
Goat(100860831) bone morphogenetic protein 2
sheep(443173) bone morphogenetic protein 2
sheep(101117688) bone morphogenetic protein 2
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013931 MISSION® esiRNA esiRNA targeting human BMP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001200 Rosetta Predictions human pricing
NM_017178 Rosetta Predictions rat pricing
NM_007553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016027 predicted 1245
2 SASI_Hs01_00016028 predicted 1561
3 SASI_Hs01_00016029 predicted 1319
4 SASI_Hs01_00016030 predicted 1488
5 SASI_Hs01_00016031 predicted 1497
6 SASI_Hs01_00016032 predicted 1171
7 SASI_Hs01_00016033 predicted 921
8 SASI_Hs01_00016034 predicted 1641
9 SASI_Hs01_00016035 predicted 1362
10 SASI_Hs01_00016036 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083187 predicted 403
2 SASI_Rn01_00083188 predicted 733
3 SASI_Rn01_00083189 predicted 616
4 SASI_Rn01_00083190 predicted 524
5 SASI_Rn01_00083192 predicted 374
6 SASI_Rn01_00083194 predicted 765
7 SASI_Rn01_00083195 predicted 710
8 SASI_Rn01_00083196 predicted 405
9 SASI_Rn02_00261510 predicted 909
10 SASI_Rn02_00261511 predicted 226
11 SASI_Rn01_00083191 predicted 948
12 SASI_Rn01_00083193 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045812 predicted 827
2 SASI_Mm01_00045813 predicted 906
3 SASI_Mm01_00045814 predicted 713
4 SASI_Mm01_00045815 predicted 276
5 SASI_Mm01_00045816 predicted 644
6 SASI_Mm01_00045817 predicted 332
7 SASI_Mm02_00311917 predicted 1046
8 SASI_Mm01_00045819 predicted 290
9 SASI_Mm01_00045820 predicted 865
10 SASI_Mm01_00045821 predicted 809
11 SASI_Mm01_00045818 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001200
BMP2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-795s1c1
Sequence:CCGGCAAGATGCTTTAGGAAACAATCTCGAGATTGTTTCCTAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1217s1c1
Sequence:CCGGACACCCTTTGTACGTGGACTTCTCGAGAAGTCCACGTACAAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-655s1c1
Sequence:CCGGGCTTCCACCATGAAGAATCTTCTCGAGAAGATTCTTCATGGTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-710s1c1
Sequence:CCGGCCGGAGATTCTTCTTTAATTTCTCGAGAAATTAAAGAAGAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1326s1c1
Sequence:CCGGGATCATCTGAACTCCACTAATCTCGAGATTAGTGGAGTTCAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001200
BMP2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-795s1c1
Sequence:CCGGCAAGATGCTTTAGGAAACAATCTCGAGATTGTTTCCTAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1217s1c1
Sequence:CCGGACACCCTTTGTACGTGGACTTCTCGAGAAGTCCACGTACAAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-655s1c1
Sequence:CCGGGCTTCCACCATGAAGAATCTTCTCGAGAAGATTCTTCATGGTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-710s1c1
Sequence:CCGGCCGGAGATTCTTCTTTAATTTCTCGAGAAATTAAAGAAGAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1326s1c1
Sequence:CCGGGATCATCTGAACTCCACTAATCTCGAGATTAGTGGAGTTCAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001200
BMP2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-795s1c1
Sequence:CCGGCAAGATGCTTTAGGAAACAATCTCGAGATTGTTTCCTAAAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1217s1c1
Sequence:CCGGACACCCTTTGTACGTGGACTTCTCGAGAAGTCCACGTACAAAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-655s1c1
Sequence:CCGGGCTTCCACCATGAAGAATCTTCTCGAGAAGATTCTTCATGGTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-710s1c1
Sequence:CCGGCCGGAGATTCTTCTTTAATTTCTCGAGAAATTAAAGAAGAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001200.1-1326s1c1
Sequence:CCGGGATCATCTGAACTCCACTAATCTCGAGATTAGTGGAGTTCAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007553
BMP2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1299s1c1
Sequence:CCGGCCTCCGGGCTATCATGCCTTTCTCGAGAAAGGCATGATAGCCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-741s1c1
Sequence:CCGGCGGCGCTTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGAAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-524s1c1
Sequence:CCGGGCTCAGCATGTTTGGCCTGAACTCGAGTTCAGGCCAAACATGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1069s1c1
Sequence:CCGGCCAAGAGACATGTGAGGATTACTCGAGTAATCCTCACATGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-851s1c1
Sequence:CCGGCCAGCACCGAATTAATATTTACTCGAGTAAATATTAATTCGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-1624s21c1
Sequence:CCGGGTATAATGGTCAGAGTTATTTCTCGAGAAATAACTCTGACCATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-546s21c1
Sequence:CCGGGGCGCTTCTTCTTCAATTTAACTCGAGTTAAATTGAAGAAGAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-296s21c1
Sequence:CCGGGAAGACGTCCTCAGCGAATTTCTCGAGAAATTCGCTGAGGACGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-1340s21c1
Sequence:CCGGCGTTAGCACAGCAAGAATAAACTCGAGTTTATTCTTGCTGTGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-710s21c1
Sequence:CCGGTTTCCTGTGACCAGACTATTGCTCGAGCAATAGTCTGGTCACAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-649s21c1
Sequence:CCGGTAGTTTCCAGCACCGAATTAACTCGAGTTAATTCGGTGCTGGAAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-2169s21c1
Sequence:CCGGGATCTGGCCAAAGTACTAAATCTCGAGATTTAGTACTTTGGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-884s21c1
Sequence:CCGGGTGAGGATTAGCAGGTCTTTGCTCGAGCAAAGACCTGCTAATCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007553
BMP2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1299s1c1
Sequence:CCGGCCTCCGGGCTATCATGCCTTTCTCGAGAAAGGCATGATAGCCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-741s1c1
Sequence:CCGGCGGCGCTTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGAAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-524s1c1
Sequence:CCGGGCTCAGCATGTTTGGCCTGAACTCGAGTTCAGGCCAAACATGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1069s1c1
Sequence:CCGGCCAAGAGACATGTGAGGATTACTCGAGTAATCCTCACATGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-851s1c1
Sequence:CCGGCCAGCACCGAATTAATATTTACTCGAGTAAATATTAATTCGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-1624s21c1
Sequence:CCGGGTATAATGGTCAGAGTTATTTCTCGAGAAATAACTCTGACCATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-546s21c1
Sequence:CCGGGGCGCTTCTTCTTCAATTTAACTCGAGTTAAATTGAAGAAGAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-296s21c1
Sequence:CCGGGAAGACGTCCTCAGCGAATTTCTCGAGAAATTCGCTGAGGACGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-1340s21c1
Sequence:CCGGCGTTAGCACAGCAAGAATAAACTCGAGTTTATTCTTGCTGTGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-710s21c1
Sequence:CCGGTTTCCTGTGACCAGACTATTGCTCGAGCAATAGTCTGGTCACAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-649s21c1
Sequence:CCGGTAGTTTCCAGCACCGAATTAACTCGAGTTAATTCGGTGCTGGAAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-2169s21c1
Sequence:CCGGGATCTGGCCAAAGTACTAAATCTCGAGATTTAGTACTTTGGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-884s21c1
Sequence:CCGGGTGAGGATTAGCAGGTCTTTGCTCGAGCAAAGACCTGCTAATCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007553
BMP2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1299s1c1
Sequence:CCGGCCTCCGGGCTATCATGCCTTTCTCGAGAAAGGCATGATAGCCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-741s1c1
Sequence:CCGGCGGCGCTTCTTCTTCAATTTACTCGAGTAAATTGAAGAAGAAGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-524s1c1
Sequence:CCGGGCTCAGCATGTTTGGCCTGAACTCGAGTTCAGGCCAAACATGCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-1069s1c1
Sequence:CCGGCCAAGAGACATGTGAGGATTACTCGAGTAATCCTCACATGTCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007553.1-851s1c1
Sequence:CCGGCCAGCACCGAATTAATATTTACTCGAGTAAATATTAATTCGGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-1624s21c1
Sequence:CCGGGTATAATGGTCAGAGTTATTTCTCGAGAAATAACTCTGACCATTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-546s21c1
Sequence:CCGGGGCGCTTCTTCTTCAATTTAACTCGAGTTAAATTGAAGAAGAAGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-296s21c1
Sequence:CCGGGAAGACGTCCTCAGCGAATTTCTCGAGAAATTCGCTGAGGACGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-1340s21c1
Sequence:CCGGCGTTAGCACAGCAAGAATAAACTCGAGTTTATTCTTGCTGTGCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-710s21c1
Sequence:CCGGTTTCCTGTGACCAGACTATTGCTCGAGCAATAGTCTGGTCACAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-649s21c1
Sequence:CCGGTAGTTTCCAGCACCGAATTAACTCGAGTTAATTCGGTGCTGGAAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007553.2-2169s21c1
Sequence:CCGGGATCTGGCCAAAGTACTAAATCTCGAGATTTAGTACTTTGGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007553.2-884s21c1
Sequence:CCGGGTGAGGATTAGCAGGTCTTTGCTCGAGCAAAGACCTGCTAATCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks