EMAIL THIS PAGE TO A FRIEND

BMP2K

BMP2 inducible kinase

125 Gene Product Result for
Synonyms: BIKE
UniProtKB ID: Q9NSY1, O94791, Q8IYF2, Q8N2G7, Q8NHG9, Q9NTG8
Gene ID:
Human(55589) Summary: This gene is the human homolog of mouse BMP-2-inducible kinase. Bone morphogenic proteins (BMPs) play a key role in skeletal development and patterning. Expression of the mouse gene is increased during BMP-2 induced differentiation and the gene product is a putative serine/threonine protein kinase containing a nuclear localization signal. Therefore, the protein encoded by this human homolog is thought to be a protein kinase with a putative regulatory role in attenuating the program of osteoblast differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(140780) BMP2 inducible kinase
Rat(498333) BMP-2 inducible kinase
Zebrafish(494101) BMP2 inducible kinase
cow(505766) BMP2 inducible kinase
chicken(422578) BMP2 inducible kinase
dog(487819) BMP2 inducible kinase
Horse(100059466) BMP2 inducible kinase
domestic cat(101094669) BMP2 inducible kinase
sheep(101107523) BMP2 inducible kinase
naked mole-rat(101703962) BMP2 inducible kinase
domestic guinea pig(100721837) BMP2 inducible kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017593 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076681 MISSION® esiRNA esiRNA human BMP2K (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017593 Rosetta Predictions human pricing
NM_198892 Rosetta Predictions human pricing
XM_001075969 Rosetta Predictions rat pricing
XM_573559 Rosetta Predictions rat pricing
NM_080708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153063 predicted 729
2 SASI_Hs01_00153064 predicted 1019
3 SASI_Hs01_00153067 predicted 673
4 SASI_Hs01_00153068 predicted 917
5 SASI_Hs01_00153069 predicted 851
6 SASI_Hs01_00153070 predicted 1075
7 SASI_Hs01_00153071 predicted 1045
8 SASI_Hs02_00350264 predicted 676
9 SASI_Hs01_00153072 predicted 870
10 SASI_Hs02_00350265 predicted 490
11 SASI_Hs01_00153065 predicted 997
12 SASI_Hs01_00153066 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089671 predicted 729
2 SASI_Hs01_00089672 predicted 1021
3 SASI_Hs01_00089675 predicted 678
4 SASI_Hs01_00089676 predicted 916
5 SASI_Hs01_00089677 predicted 856
6 SASI_Hs01_00089678 predicted 1075
7 SASI_Hs01_00089679 predicted 1046
8 SASI_Hs02_00372394 predicted 667
9 SASI_Hs01_00089680 predicted 865
10 SASI_Hs02_00372395 predicted 488
11 SASI_Hs01_00089673 predicted 994
12 SASI_Hs01_00089674 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351661 predicted 177
2 SASI_Rn02_00351662 predicted 62
3 SASI_Rn02_00351663 predicted 111
4 SASI_Rn02_00351664 predicted 194
5 SASI_Rn02_00351665 predicted 167
6 SASI_Rn02_00351666 predicted 63
7 SASI_Rn02_00351667 predicted 78
8 SASI_Rn02_00351668 predicted 111
9 SASI_Rn02_00351669 predicted 62
10 SASI_Rn02_00351670 predicted 90
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400497 predicted 3053
2 SASI_Rn02_00400498 predicted 3040
3 SASI_Rn02_00400499 predicted 3078
4 SASI_Rn02_00400500 predicted 2977
5 SASI_Rn02_00400501 predicted 2996
6 SASI_Rn02_00400502 predicted 2910
7 SASI_Rn02_00400503 predicted 3083
8 SASI_Rn02_00400504 predicted 2984
9 SASI_Rn02_00400505 predicted 3074
10 SASI_Rn02_00400506 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073701 predicted 982
2 SASI_Mm01_00073702 predicted 2033
3 SASI_Mm01_00073703 predicted 2129
4 SASI_Mm01_00073704 predicted 3618
5 SASI_Mm01_00073705 predicted 918
6 SASI_Mm01_00073706 predicted 3535
7 SASI_Mm01_00073707 predicted 2512
8 SASI_Mm01_00073708 predicted 1158
9 SASI_Mm01_00073709 predicted 2481
10 SASI_Mm01_00073710 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080708
VALIDATED
BMP2K MISSION shRNA Bacterial Glycerol Stock
BMP2 inducible kinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080708.1-2380s21c1
Sequence:CCGGCCTCCGAGAATCCCGTAATTACTCGAGTAATTACGGGATTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1200s21c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1161s21c1
Sequence:CCGGGTATCCTACTTTGCGTTTAAACTCGAGTTTAAACGCAAAGTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-3754s21c1
Sequence:CCGGTACACTCTTCACAGGTTAATCCTCGAGGATTAACCTGTGAAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-682s21c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2952s1c1
Sequence:CCGGCGGCCCAGAAGTGTAGATATACTCGAGTATATCTACACTTCTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2284s1c1
Sequence:CCGGCGGAACATTCTCCAAATCAAACTCGAGTTTGATTTGGAGAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-489s1c1
Sequence:CCGGCCCGACCTCAACATTTGTAAACTCGAGTTTACAAATGTTGAGGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-1200s1c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-682s1c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080708
VALIDATED
BMP2K MISSION shRNA shRNA Plasmid DNA
BMP2 inducible kinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080708.1-2380s21c1
Sequence:CCGGCCTCCGAGAATCCCGTAATTACTCGAGTAATTACGGGATTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1200s21c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1161s21c1
Sequence:CCGGGTATCCTACTTTGCGTTTAAACTCGAGTTTAAACGCAAAGTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-3754s21c1
Sequence:CCGGTACACTCTTCACAGGTTAATCCTCGAGGATTAACCTGTGAAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-682s21c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2952s1c1
Sequence:CCGGCGGCCCAGAAGTGTAGATATACTCGAGTATATCTACACTTCTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2284s1c1
Sequence:CCGGCGGAACATTCTCCAAATCAAACTCGAGTTTGATTTGGAGAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-489s1c1
Sequence:CCGGCCCGACCTCAACATTTGTAAACTCGAGTTTACAAATGTTGAGGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-1200s1c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-682s1c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080708
VALIDATED
BMP2K MISSION shRNA Lentiviral Transduction Particles
BMP2 inducible kinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080708.1-2380s21c1
Sequence:CCGGCCTCCGAGAATCCCGTAATTACTCGAGTAATTACGGGATTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1200s21c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-1161s21c1
Sequence:CCGGGTATCCTACTTTGCGTTTAAACTCGAGTTTAAACGCAAAGTAGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-3754s21c1
Sequence:CCGGTACACTCTTCACAGGTTAATCCTCGAGGATTAACCTGTGAAGAGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_080708.1-682s21c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2952s1c1
Sequence:CCGGCGGCCCAGAAGTGTAGATATACTCGAGTATATCTACACTTCTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-2284s1c1
Sequence:CCGGCGGAACATTCTCCAAATCAAACTCGAGTTTGATTTGGAGAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-489s1c1
Sequence:CCGGCCCGACCTCAACATTTGTAAACTCGAGTTTACAAATGTTGAGGTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-1200s1c1
Sequence:CCGGCCGGTCTCCAACATCAATAATCTCGAGATTATTGATGTTGGAGACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_080708.1-682s1c1
Sequence:CCGGCCGAGTCAGAAGTCCTACAAACTCGAGTTTGTAGGACTTCTGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017593
VALIDATED
BMP2K MISSION shRNA Bacterial Glycerol Stock
BMP2 inducible kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-1071s21c1
Sequence:CCGGCGGAACATAGACCTGATATATCTCGAGATATATCAGGTCTATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-2102s21c1
Sequence:GTACCGGGACCTTCTAAGATCAAGTAAGCTCGAGCTTACTTGATCTTAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017593.3-2299s21c1
Sequence:CCGGTTGCTTGATAGTAGCTATTAACTCGAGTTAATAGCTACTATCAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-760s21c1
Sequence:CCGGCTTTGGCAGTGCCACTAATAACTCGAGTTATTAGTGGCACTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017593.x-2687s1c1
Sequence:CCGGGCTGCTTTGTTGTCCTGATATCTCGAGATATCAGGACAACAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017593.x-1237s1c1
Sequence:CCGGTCTTCTATTCCTTCAGCTCTTCTCGAGAAGAGCTGAAGGAATAGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-953s1c1
Sequence:CCGGGCACTGGGATGTCTACTCTATCTCGAGATAGAGTAGACATCCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-539s1c1
Sequence:CCGGGACTGTGCTGTTAATTCAATTCTCGAGAATTGAATTAACAGCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017593.3-2246s1c1
Sequence:CCGGGCCATCTTCTTATACATATACCTCGAGGTATATGTATAAGAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017593.3-1980s1c1
Sequence:CCGGCCATTGCAAATTTCACAAATCCTCGAGGATTTGTGAAATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017593
VALIDATED
BMP2K MISSION shRNA shRNA Plasmid DNA
BMP2 inducible kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-1071s21c1
Sequence:CCGGCGGAACATAGACCTGATATATCTCGAGATATATCAGGTCTATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-2102s21c1
Sequence:GTACCGGGACCTTCTAAGATCAAGTAAGCTCGAGCTTACTTGATCTTAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017593.3-2299s21c1
Sequence:CCGGTTGCTTGATAGTAGCTATTAACTCGAGTTAATAGCTACTATCAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-760s21c1
Sequence:CCGGCTTTGGCAGTGCCACTAATAACTCGAGTTATTAGTGGCACTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017593.x-2687s1c1
Sequence:CCGGGCTGCTTTGTTGTCCTGATATCTCGAGATATCAGGACAACAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017593.x-1237s1c1
Sequence:CCGGTCTTCTATTCCTTCAGCTCTTCTCGAGAAGAGCTGAAGGAATAGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-953s1c1
Sequence:CCGGGCACTGGGATGTCTACTCTATCTCGAGATAGAGTAGACATCCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-539s1c1
Sequence:CCGGGACTGTGCTGTTAATTCAATTCTCGAGAATTGAATTAACAGCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017593.3-2246s1c1
Sequence:CCGGGCCATCTTCTTATACATATACCTCGAGGTATATGTATAAGAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017593.3-1980s1c1
Sequence:CCGGCCATTGCAAATTTCACAAATCCTCGAGGATTTGTGAAATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017593
VALIDATED
BMP2K MISSION shRNA Lentiviral Transduction Particles
BMP2 inducible kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-1071s21c1
Sequence:CCGGCGGAACATAGACCTGATATATCTCGAGATATATCAGGTCTATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-2102s21c1
Sequence:GTACCGGGACCTTCTAAGATCAAGTAAGCTCGAGCTTACTTGATCTTAGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017593.3-2299s21c1
Sequence:CCGGTTGCTTGATAGTAGCTATTAACTCGAGTTAATAGCTACTATCAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017593.3-760s21c1
Sequence:CCGGCTTTGGCAGTGCCACTAATAACTCGAGTTATTAGTGGCACTGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017593.x-2687s1c1
Sequence:CCGGGCTGCTTTGTTGTCCTGATATCTCGAGATATCAGGACAACAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_017593.x-1237s1c1
Sequence:CCGGTCTTCTATTCCTTCAGCTCTTCTCGAGAAGAGCTGAAGGAATAGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-953s1c1
Sequence:CCGGGCACTGGGATGTCTACTCTATCTCGAGATAGAGTAGACATCCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017593.x-539s1c1
Sequence:CCGGGACTGTGCTGTTAATTCAATTCTCGAGAATTGAATTAACAGCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017593.3-2246s1c1
Sequence:CCGGGCCATCTTCTTATACATATACCTCGAGGTATATGTATAAGAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017593.3-1980s1c1
Sequence:CCGGCCATTGCAAATTTCACAAATCCTCGAGGATTTGTGAAATTTGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks