EMAIL THIS PAGE TO A FRIEND

BMP2KL

BMP2 inducible kinase-like

34 Gene Product Result for
Species: Human BMP2KL(347359)
UniProtKB ID: Q5H9B9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293293 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128991 MISSION® esiRNA esiRNA human BMP2KL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715684 Rosetta Predictions human pricing
XM_293293 Rosetta Predictions human pricing
XM_936694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405380 predicted 318
2 SASI_Hs02_00405381 predicted 1008
3 SASI_Hs02_00405382 predicted 323
4 SASI_Hs02_00405383 predicted 306
5 SASI_Hs02_00405384 predicted 890
6 SASI_Hs02_00405385 predicted 927
7 SASI_Hs02_00405386 predicted 542
8 SASI_Hs02_00405387 predicted 223
9 SASI_Hs02_00405388 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280924 predicted 308
2 SASI_Hs01_00280915 predicted 991
3 SASI_Hs02_00479140 predicted 314
4 SASI_Hs02_00479141 predicted 296
5 SASI_Hs01_00280916 predicted 875
6 SASI_Hs01_00280917 predicted 913
7 SASI_Hs02_00479142 predicted 528
8 SASI_Hs02_00479143 predicted 214
9 SASI_Hs02_00479144 predicted 201
10 SASI_Hs01_00280918 predicted 841
11 SASI_Hs01_00280919 predicted 831
12 SASI_Hs01_00280920 predicted 920
13 SASI_Hs01_00280921 predicted 1016
14 SASI_Hs01_00280922 predicted 897
15 SASI_Hs01_00280923 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482191 predicted 307
2 SASI_Hs02_00482192 predicted 990
3 SASI_Hs02_00482193 predicted 313
4 SASI_Hs02_00482194 predicted 291
5 SASI_Hs02_00482195 predicted 879
6 SASI_Hs02_00482196 predicted 921
7 SASI_Hs02_00482197 predicted 526
8 SASI_Hs02_00482198 predicted 207
9 SASI_Hs02_00482199 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293293
BMP2KL MISSION shRNA Bacterial Glycerol Stock
BMP2 inducible kinase-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-829s1c1
Sequence:CCGGCGAGTCTCTCAAACCAGCAATCTCGAGATTGCTGGTTTGAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-316s1c1
Sequence:CCGGCCTAAACAGGAGTTCGATATACTCGAGTATATCGAACTCCTGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-215s1c1
Sequence:CCGGGCCCTGTCTACAGAGACAAATCTCGAGATTTGTCTCTGTAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-121s1c1
Sequence:CCGGCCTCTCCTCATGGATTCTGAACTCGAGTTCAGAATCCATGAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-438s1c1
Sequence:CCGGGCAGGAGGAATTTGATGTATTCTCGAGAATACATCAAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293293
BMP2KL MISSION shRNA shRNA Plasmid DNA
BMP2 inducible kinase-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-829s1c1
Sequence:CCGGCGAGTCTCTCAAACCAGCAATCTCGAGATTGCTGGTTTGAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-316s1c1
Sequence:CCGGCCTAAACAGGAGTTCGATATACTCGAGTATATCGAACTCCTGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-215s1c1
Sequence:CCGGGCCCTGTCTACAGAGACAAATCTCGAGATTTGTCTCTGTAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-121s1c1
Sequence:CCGGCCTCTCCTCATGGATTCTGAACTCGAGTTCAGAATCCATGAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-438s1c1
Sequence:CCGGGCAGGAGGAATTTGATGTATTCTCGAGAATACATCAAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293293
BMP2KL MISSION shRNA Lentiviral Transduction Particles
BMP2 inducible kinase-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-829s1c1
Sequence:CCGGCGAGTCTCTCAAACCAGCAATCTCGAGATTGCTGGTTTGAGAGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-316s1c1
Sequence:CCGGCCTAAACAGGAGTTCGATATACTCGAGTATATCGAACTCCTGTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-215s1c1
Sequence:CCGGGCCCTGTCTACAGAGACAAATCTCGAGATTTGTCTCTGTAGACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-121s1c1
Sequence:CCGGCCTCTCCTCATGGATTCTGAACTCGAGTTCAGAATCCATGAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293293.1-438s1c1
Sequence:CCGGGCAGGAGGAATTTGATGTATTCTCGAGAATACATCAAATTCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks