EMAIL THIS PAGE TO A FRIEND

BMP3

bone morphogenetic protein 3

50 Gene Product Result for
Synonyms: BMP-3A
UniProtKB ID: P12645, Q4VAS5
Gene ID:
Human(651) Summary: BMP3 belongs to the transforming growth factor-beta (TGFB) superfamily. Bone morphogenic protein, also known as osteogenin, induces bone formation. [provided by RefSeq, Jul 2008]
Mouse(110075) bone morphogenetic protein 3
Rat(25667) bone morphogenetic protein 3
Zebrafish(777717) bone morphogenetic protein 3
chicken(422581) bone morphogenetic protein 3
cow(539527) bone morphogenetic protein 3
domestic cat(101093182) bone morphogenetic protein 3
dog(487826) bone morphogenetic protein 3
domestic guinea pig(100723683) bone morphogenetic protein 3
naked mole-rat(101698732) bone morphogenetic protein 3
sheep(101108049) bone morphogenetic protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0628 Human BMP3 / Bone Morphogenetic Protein 3 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043341 MISSION® esiRNA esiRNA human BMP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001201 Rosetta Predictions human pricing
NM_017105 Rosetta Predictions rat pricing
NM_173404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153686 predicted 1426
2 SASI_Hs01_00153687 predicted 648
3 SASI_Hs01_00153688 predicted 1000
4 SASI_Hs01_00153689 predicted 719
5 SASI_Hs01_00153690 predicted 1085
6 SASI_Hs01_00153691 predicted 1494
7 SASI_Hs01_00153692 predicted 880
8 SASI_Hs01_00153694 predicted 1075
9 SASI_Hs02_00331340 predicted 1071
10 SASI_Hs01_00153693 predicted 910
11 SASI_Hs01_00153695 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042024 predicted 953
2 SASI_Rn01_00042025 predicted 1722
3 SASI_Rn01_00042026 predicted 1637
4 SASI_Rn01_00042027 predicted 920
5 SASI_Rn01_00042029 predicted 1901
6 SASI_Rn01_00042030 predicted 1533
7 SASI_Rn02_00261336 predicted 1436
8 SASI_Rn01_00042031 predicted 1228
9 SASI_Rn01_00042032 predicted 985
10 SASI_Rn01_00042033 predicted 1414
11 SASI_Rn01_00042028 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196097 predicted 1608
2 SASI_Mm01_00196098 predicted 1722
3 SASI_Mm01_00196099 predicted 1813
4 SASI_Mm01_00196100 predicted 1423
5 SASI_Mm01_00196101 predicted 1799
6 SASI_Mm01_00196102 predicted 1209
7 SASI_Mm01_00196103 predicted 1490
8 SASI_Mm01_00196104 predicted 1132
9 SASI_Mm01_00196105 predicted 1165
10 SASI_Mm01_00196106 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001201
BMP3 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1117s1c1
Sequence:CCGGCCACTGGAACTGTTCCCAAATCTCGAGATTTGGGAACAGTTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1491s1c1
Sequence:CCGGCCCAAGTCCTTTGATGCCTATCTCGAGATAGGCATCAAAGGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1026s1c1
Sequence:CCGGCCAGAGCCTTATATCTTGGTACTCGAGTACCAAGATATAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-474s1c1
Sequence:CCGGCCGCAAGACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-708s1c1
Sequence:CCGGGCCACACTGTATTTCTGTATTCTCGAGAATACAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1409s21c1
Sequence:CCGGGTGGATTGAACCTCGGAATTGCTCGAGCAATTCCGAGGTTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1094s21c1
Sequence:CCGGCTTACAGGGACACCGGAATTTCTCGAGAAATTCCGGTGTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-881s21c1
Sequence:CCGGGGCCAAATCTCATCGAGATATCTCGAGATATCTCGATGAGATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001201
BMP3 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1117s1c1
Sequence:CCGGCCACTGGAACTGTTCCCAAATCTCGAGATTTGGGAACAGTTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1491s1c1
Sequence:CCGGCCCAAGTCCTTTGATGCCTATCTCGAGATAGGCATCAAAGGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1026s1c1
Sequence:CCGGCCAGAGCCTTATATCTTGGTACTCGAGTACCAAGATATAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-474s1c1
Sequence:CCGGCCGCAAGACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-708s1c1
Sequence:CCGGGCCACACTGTATTTCTGTATTCTCGAGAATACAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1409s21c1
Sequence:CCGGGTGGATTGAACCTCGGAATTGCTCGAGCAATTCCGAGGTTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1094s21c1
Sequence:CCGGCTTACAGGGACACCGGAATTTCTCGAGAAATTCCGGTGTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-881s21c1
Sequence:CCGGGGCCAAATCTCATCGAGATATCTCGAGATATCTCGATGAGATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001201
BMP3 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1117s1c1
Sequence:CCGGCCACTGGAACTGTTCCCAAATCTCGAGATTTGGGAACAGTTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1491s1c1
Sequence:CCGGCCCAAGTCCTTTGATGCCTATCTCGAGATAGGCATCAAAGGACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-1026s1c1
Sequence:CCGGCCAGAGCCTTATATCTTGGTACTCGAGTACCAAGATATAAGGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-474s1c1
Sequence:CCGGCCGCAAGACAAGGTCTCTGAACTCGAGTTCAGAGACCTTGTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001201.1-708s1c1
Sequence:CCGGGCCACACTGTATTTCTGTATTCTCGAGAATACAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1409s21c1
Sequence:CCGGGTGGATTGAACCTCGGAATTGCTCGAGCAATTCCGAGGTTCAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-1094s21c1
Sequence:CCGGCTTACAGGGACACCGGAATTTCTCGAGAAATTCCGGTGTCCCTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001201.2-881s21c1
Sequence:CCGGGGCCAAATCTCATCGAGATATCTCGAGATATCTCGATGAGATTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173404
BMP3 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1370s1c1
Sequence:CCGGCGGAACCTTATATCTTGGTATCTCGAGATACCAAGATATAAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1879s1c1
Sequence:CCGGCCCATGCCAAAGTCTTTGAAACTCGAGTTTCAAAGACTTTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-708s1c1
Sequence:CCGGGCTAGGTTACTTCTGCCTGAACTCGAGTTCAGGCAGAAGTAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1436s1c1
Sequence:CCGGGCTTACAGAGACACCGAGATTCTCGAGAATCTCGGTGTCTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1057s1c1
Sequence:CCGGGCCACACTGTATTTCTACGTTCTCGAGAACGTAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173404
BMP3 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1370s1c1
Sequence:CCGGCGGAACCTTATATCTTGGTATCTCGAGATACCAAGATATAAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1879s1c1
Sequence:CCGGCCCATGCCAAAGTCTTTGAAACTCGAGTTTCAAAGACTTTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-708s1c1
Sequence:CCGGGCTAGGTTACTTCTGCCTGAACTCGAGTTCAGGCAGAAGTAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1436s1c1
Sequence:CCGGGCTTACAGAGACACCGAGATTCTCGAGAATCTCGGTGTCTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1057s1c1
Sequence:CCGGGCCACACTGTATTTCTACGTTCTCGAGAACGTAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173404
BMP3 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1370s1c1
Sequence:CCGGCGGAACCTTATATCTTGGTATCTCGAGATACCAAGATATAAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1879s1c1
Sequence:CCGGCCCATGCCAAAGTCTTTGAAACTCGAGTTTCAAAGACTTTGGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-708s1c1
Sequence:CCGGGCTAGGTTACTTCTGCCTGAACTCGAGTTCAGGCAGAAGTAACCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1436s1c1
Sequence:CCGGGCTTACAGAGACACCGAGATTCTCGAGAATCTCGGTGTCTCTGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173404.1-1057s1c1
Sequence:CCGGGCCACACTGTATTTCTACGTTCTCGAGAACGTAGAAATACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks