EMAIL THIS PAGE TO A FRIEND

BMP4

bone morphogenetic protein 4

99 Gene Product Result for
Synonyms: BMP2B BMP2B1 MCOPS6 OFC11 ZYME
UniProtKB ID: P12644, Q9UM80
Gene ID:
Human(652) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. The superfamily includes large families of growth and differentiation factors. Bone morphogenetic proteins were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. This particular family member plays an important role in the onset of endochondral bone formation in humans, and a reduction in expression has been associated with a variety of bone diseases, including the heritable disorder Fibrodysplasia Ossificans Progressiva. Alternative splicing in the 5' untranslated region of this gene has been described and three variants are described, all encoding an identical protein. [provided by RefSeq, Jul 2008]
Mouse(12159) bone morphogenetic protein 4
Rat(25296) bone morphogenetic protein 4
Goat(100860789) bone morphogenetic protein 4
Domestic Rabbit(100009569) bone morphogenetic protein 4
sheep(443502) bone morphogenetic protein 4
naked mole-rat(101711207) bone morphogenetic protein 4
domestic guinea pig(100733516) bone morphogenetic protein 4
Zebrafish(30612) bone morphogenetic protein 4
domestic cat(101100311) bone morphogenetic protein 4
cow(407216) bone morphogenetic protein 4
Horse(100034048) bone morphogenetic protein 4
dog(490695) bone morphogenetic protein 4
chicken(396165) bone morphogenetic protein 4
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200516 Anti-BMP4 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2702452 Anti-Bmp4 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB4200556 Anti-BMP4 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB2700755 Anti-BMP4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2700756 Anti-BMP4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
HPA066235 Anti-BMP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB3300014 Monoclonal Anti-BMP4 antibody produced in mouse clone 6B7, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB5300528 Monoclonal Anti-BMP4 antibody produced in mouse clone 10F4B4, ascites fluid human
ELISA, western blot pricing
B9678 Monoclonal Anti-Bone Morphogenetic Protein 4 antibody produced in mouse clone 66119.11, purified immunoglobulin, lyophilized powder human
neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007554 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007554 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007554 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001202 Rosetta Predictions human pricing
NM_130850 Rosetta Predictions human pricing
NM_130851 Rosetta Predictions human pricing
NM_012827 Rosetta Predictions rat pricing
NM_007554 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122020 predicted 1092
2 SASI_Hs01_00122021 predicted 1017
3 SASI_Hs01_00122022 predicted 1019
4 SASI_Hs01_00122023 predicted 580
5 SASI_Hs01_00122024 predicted 656
6 SASI_Hs01_00122025 predicted 709
7 SASI_Hs01_00122026 predicted 1284
8 SASI_Hs01_00122027 predicted 795
9 SASI_Hs01_00122028 predicted 664
10 SASI_Hs01_00122029 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211502 predicted 878
2 SASI_Hs01_00211503 predicted 812
3 SASI_Hs01_00211504 predicted 809
4 SASI_Hs01_00211505 predicted 373
5 SASI_Hs01_00211506 predicted 448
6 SASI_Hs01_00211507 predicted 504
7 SASI_Hs01_00211508 predicted 1073
8 SASI_Hs01_00211509 predicted 579
9 SASI_Hs01_00211510 predicted 453
10 SASI_Hs01_00211511 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058611 predicted 931
2 SASI_Hs01_00058612 predicted 864
3 SASI_Hs01_00058613 predicted 862
4 SASI_Hs01_00058614 predicted 426
5 SASI_Hs01_00058615 predicted 501
6 SASI_Hs01_00058616 predicted 560
7 SASI_Hs01_00058617 predicted 1125
8 SASI_Hs01_00058618 predicted 634
9 SASI_Hs01_00058619 predicted 515
10 SASI_Hs01_00058620 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260277 predicted 744
2 SASI_Rn02_00260278 predicted 764
3 SASI_Rn01_00075610 predicted 1060
4 SASI_Rn01_00075611 predicted 364
5 SASI_Rn01_00075613 predicted 824
6 SASI_Rn01_00075614 predicted 602
7 SASI_Rn01_00075615 predicted 487
8 SASI_Rn01_00075617 predicted 294
9 SASI_Rn02_00260279 predicted 479
10 SASI_Rn01_00075619 predicted 917
11 SASI_Rn01_00075612 predicted 1005
12 SASI_Rn01_00075616 predicted 459
13 SASI_Rn01_00075618 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188509 predicted 1027
2 SASI_Mm01_00188510 predicted 724
3 SASI_Mm01_00188511 predicted 1054
4 SASI_Mm01_00188512 predicted 585
5 SASI_Mm01_00188513 predicted 1111
6 SASI_Mm01_00188514 predicted 772
7 SASI_Mm02_00311918 predicted 1176
8 SASI_Mm01_00188515 predicted 1338
9 SASI_Mm01_00188516 predicted 666
10 SASI_Mm01_00188517 predicted 774
11 SASI_Mm01_00188518 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001202
BMP4 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1162s21c1
Sequence:CCGGAGGGCCAGCATGTCAGGATTACTCGAGTAATCCTGACATGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001202.3-1657s21c1
Sequence:CCGGTCCTTGAGGATAGACAGATATCTCGAGATATCTGTCTATCCTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1096s21c1
Sequence:CCGGGGGAGAAGCAGCCAAACTATGCTCGAGCATAGTTTGGCTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1553s1c1
Sequence:CCGGCCCTGGTCAATTCTGTCAATTCTCGAGAATTGACAGAATTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-652s1c1
Sequence:CCGGGCGACACTTCTGCAGATGTTTCTCGAGAAACATCTGCAGAAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-538s1c1
Sequence:CCGGGCGAGCCATGCTAGTTTGATACTCGAGTATCAAACTAGCATGGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-840s1c1
Sequence:CCGGCCACGAAGAACATCTGGAGAACTCGAGTTCTCCAGATGTTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1636s1c1
Sequence:CCGGGATGAGTATGATAAGGTGGTACTCGAGTACCACCTTATCATACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001202
BMP4 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1162s21c1
Sequence:CCGGAGGGCCAGCATGTCAGGATTACTCGAGTAATCCTGACATGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001202.3-1657s21c1
Sequence:CCGGTCCTTGAGGATAGACAGATATCTCGAGATATCTGTCTATCCTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1096s21c1
Sequence:CCGGGGGAGAAGCAGCCAAACTATGCTCGAGCATAGTTTGGCTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1553s1c1
Sequence:CCGGCCCTGGTCAATTCTGTCAATTCTCGAGAATTGACAGAATTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-652s1c1
Sequence:CCGGGCGACACTTCTGCAGATGTTTCTCGAGAAACATCTGCAGAAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-538s1c1
Sequence:CCGGGCGAGCCATGCTAGTTTGATACTCGAGTATCAAACTAGCATGGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-840s1c1
Sequence:CCGGCCACGAAGAACATCTGGAGAACTCGAGTTCTCCAGATGTTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1636s1c1
Sequence:CCGGGATGAGTATGATAAGGTGGTACTCGAGTACCACCTTATCATACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001202
BMP4 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1162s21c1
Sequence:CCGGAGGGCCAGCATGTCAGGATTACTCGAGTAATCCTGACATGCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001202.3-1657s21c1
Sequence:CCGGTCCTTGAGGATAGACAGATATCTCGAGATATCTGTCTATCCTCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001202.3-1096s21c1
Sequence:CCGGGGGAGAAGCAGCCAAACTATGCTCGAGCATAGTTTGGCTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1553s1c1
Sequence:CCGGCCCTGGTCAATTCTGTCAATTCTCGAGAATTGACAGAATTGACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-652s1c1
Sequence:CCGGGCGACACTTCTGCAGATGTTTCTCGAGAAACATCTGCAGAAGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-538s1c1
Sequence:CCGGGCGAGCCATGCTAGTTTGATACTCGAGTATCAAACTAGCATGGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-840s1c1
Sequence:CCGGCCACGAAGAACATCTGGAGAACTCGAGTTCTCCAGATGTTCTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001202.2-1636s1c1
Sequence:CCGGGATGAGTATGATAAGGTGGTACTCGAGTACCACCTTATCATACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007554
VALIDATED
BMP4 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007554.2-1735s21c1
Sequence:CCGGCATTCAACCACCTACACATACCTCGAGGTATGTGTAGGTGGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-668s21c1
Sequence:CCGGGGATTACATGAGGGATCTTTACTCGAGTAAAGATCCCTCATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1504s21c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-947s21c1
Sequence:CCGGACAGGGCTTCCACCGTATAAACTCGAGTTTATACGGTGGAAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1358s21c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-966s1c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-1112s1c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-35s1c1
Sequence:CCGGCCATGATTCCTGGTAACCGAACTCGAGTTCGGTTACCAGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-211s1c1
Sequence:CCGGGCGACACTTCTACAGATGTTTCTCGAGAAACATCTGTAGAAGTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-274s1c1
Sequence:CCGGCCGGATTACATGAGGGATCTTCTCGAGAAGATCCCTCATGTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007554
VALIDATED
BMP4 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007554.2-1735s21c1
Sequence:CCGGCATTCAACCACCTACACATACCTCGAGGTATGTGTAGGTGGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-668s21c1
Sequence:CCGGGGATTACATGAGGGATCTTTACTCGAGTAAAGATCCCTCATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1504s21c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-947s21c1
Sequence:CCGGACAGGGCTTCCACCGTATAAACTCGAGTTTATACGGTGGAAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1358s21c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-966s1c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-1112s1c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-35s1c1
Sequence:CCGGCCATGATTCCTGGTAACCGAACTCGAGTTCGGTTACCAGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-211s1c1
Sequence:CCGGGCGACACTTCTACAGATGTTTCTCGAGAAACATCTGTAGAAGTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-274s1c1
Sequence:CCGGCCGGATTACATGAGGGATCTTCTCGAGAAGATCCCTCATGTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007554
VALIDATED
BMP4 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007554.2-1735s21c1
Sequence:CCGGCATTCAACCACCTACACATACCTCGAGGTATGTGTAGGTGGTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-668s21c1
Sequence:CCGGGGATTACATGAGGGATCTTTACTCGAGTAAAGATCCCTCATGTAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1504s21c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-947s21c1
Sequence:CCGGACAGGGCTTCCACCGTATAAACTCGAGTTTATACGGTGGAAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007554.2-1358s21c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-966s1c1
Sequence:CCGGCCATTCACTATACGTGGACTTCTCGAGAAGTCCACGTATAGTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-1112s1c1
Sequence:CCGGCCCTAGTCAACTCTGTTAATTCTCGAGAATTAACAGAGTTGACTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-35s1c1
Sequence:CCGGCCATGATTCCTGGTAACCGAACTCGAGTTCGGTTACCAGGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007554.1-211s1c1
Sequence:CCGGGCGACACTTCTACAGATGTTTCTCGAGAAACATCTGTAGAAGTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007554.1-274s1c1
Sequence:CCGGCCGGATTACATGAGGGATCTTCTCGAGAAGATCCCTCATGTAATCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks