EMAIL THIS PAGE TO A FRIEND

BMP5

bone morphogenetic protein 5

60 Gene Product Result for
UniProtKB ID: P22003, Q9H547, Q9NTM5
Gene ID:
Human(653) Summary: This gene encodes a member of the bone morphogenetic protein family which is part of the transforming growth factor-beta superfamily. The superfamily includes large families of growth and differentiation factors. Bone morphogenetic proteins were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. These proteins are synthesized as prepropeptides, cleaved, and then processed into dimeric proteins. This protein may act as an important signaling molecule within the trabecular meshwork and optic nerve head, and may play a potential role in glaucoma pathogenesis. This gene is differentially regulated during the formation of various tumors. [provided by RefSeq, Jul 2008]
Mouse(12160) bone morphogenetic protein 5
Rat(315824) bone morphogenetic protein 5
naked mole-rat(101723820) bone morphogenetic protein 5
domestic guinea pig(100729769) bone morphogenetic protein 5
sheep(101107231) bone morphogenetic protein 5
Domestic Rabbit(100344917) bone morphogenetic protein 5
Zebrafish(394026) bone morphogenetic protein 5
cow(507682) bone morphogenetic protein 5
Horse(100056806) bone morphogenetic protein 5
domestic cat(101097318) bone morphogenetic protein 5
dog(474944) bone morphogenetic protein 5
chicken(396053) bone morphogenetic protein 5
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301926 Anti-BMP5 affinity isolated antibody mouse, human
western blot pricing
SAB1412321 ANTI-BMP5 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412410 ANTI-BMP5 antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412411 ANTI-BMP5 antibody produced in mouse clone 2A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412412 ANTI-BMP5 antibody produced in mouse clone 3D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412413 ANTI-BMP5 antibody produced in mouse clone 3H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412426 ANTI-BMP5 antibody produced in mouse clone 4B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412427 ANTI-BMP5 antibody produced in mouse clone 4A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412428 ANTI-BMP5 antibody produced in mouse clone 4D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411288 Anti-BMP5 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
B3805 Anti-Bone Morphogenetic Protein 5 antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
WH0000653M2 Monoclonal Anti-BMP5 antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403610 Monoclonal Anti-BMP5 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005831 MISSION® esiRNA esiRNA targeting human BMP5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021073 Rosetta Predictions human pricing
NM_001108168 Rosetta Predictions rat pricing
NM_007555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133810 predicted 1474
2 SASI_Hs01_00133811 predicted 1237
3 SASI_Hs01_00133812 predicted 1243
4 SASI_Hs01_00133813 predicted 1471
5 SASI_Hs01_00133814 predicted 1249
6 SASI_Hs01_00133815 predicted 1420
7 SASI_Hs01_00133816 predicted 1399
8 SASI_Hs02_00354555 predicted 1506
9 SASI_Hs01_00133818 predicted 1240
10 SASI_Hs02_00354556 predicted 1511
11 SASI_Hs01_00133817 predicted 1383
12 SASI_Hs01_00133819 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236024 predicted 480
2 SASI_Rn02_00236025 predicted 781
3 SASI_Rn02_00236026 predicted 1396
4 SASI_Rn02_00236027 predicted 1059
5 SASI_Rn02_00236028 predicted 674
6 SASI_Rn02_00236029 predicted 249
7 SASI_Rn02_00236030 predicted 395
8 SASI_Rn02_00236031 predicted 309
9 SASI_Rn02_00236032 predicted 524
10 SASI_Rn02_00236033 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077041 predicted 1884
2 SASI_Mm01_00077042 predicted 1310
3 SASI_Mm01_00077043 predicted 2113
4 SASI_Mm01_00077044 predicted 1203
5 SASI_Mm01_00077045 predicted 1704
6 SASI_Mm01_00077046 predicted 1257
7 SASI_Mm01_00077047 predicted 1318
8 SASI_Mm01_00077048 predicted 1778
9 SASI_Mm01_00077049 predicted 1525
10 SASI_Mm01_00077050 predicted 2121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021073
BMP5 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1476s1c1
Sequence:CCGGCCAGCAATCATTGGGTGATTACTCGAGTAATCACCCAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1322s1c1
Sequence:CCGGCGGAGCAACAACCGATTTGAACTCGAGTTCAAATCGGTTGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-855s1c1
Sequence:CCGGGACGGGAAATACAAAGGGAAACTCGAGTTTCCCTTTGTATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-941s1c1
Sequence:CCGGGCACCTCTCTTTATGCTGGATCTCGAGATCCAGCATAAAGAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1832s1c1
Sequence:CCGGCCAGAAGGATACGCTGCATTTCTCGAGAAATGCAGCGTATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1543s21c1
Sequence:CCGGTGGACGCAGTATCAACGTAAACTCGAGTTTACGTTGATACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1896s21c1
Sequence:CCGGATGCCACCAACCACGCTATAGCTCGAGCTATAGCGTGGTTGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021073
BMP5 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1476s1c1
Sequence:CCGGCCAGCAATCATTGGGTGATTACTCGAGTAATCACCCAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1322s1c1
Sequence:CCGGCGGAGCAACAACCGATTTGAACTCGAGTTCAAATCGGTTGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-855s1c1
Sequence:CCGGGACGGGAAATACAAAGGGAAACTCGAGTTTCCCTTTGTATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-941s1c1
Sequence:CCGGGCACCTCTCTTTATGCTGGATCTCGAGATCCAGCATAAAGAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1832s1c1
Sequence:CCGGCCAGAAGGATACGCTGCATTTCTCGAGAAATGCAGCGTATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1543s21c1
Sequence:CCGGTGGACGCAGTATCAACGTAAACTCGAGTTTACGTTGATACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1896s21c1
Sequence:CCGGATGCCACCAACCACGCTATAGCTCGAGCTATAGCGTGGTTGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021073
BMP5 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1476s1c1
Sequence:CCGGCCAGCAATCATTGGGTGATTACTCGAGTAATCACCCAATGATTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1322s1c1
Sequence:CCGGCGGAGCAACAACCGATTTGAACTCGAGTTCAAATCGGTTGTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-855s1c1
Sequence:CCGGGACGGGAAATACAAAGGGAAACTCGAGTTTCCCTTTGTATTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-941s1c1
Sequence:CCGGGCACCTCTCTTTATGCTGGATCTCGAGATCCAGCATAAAGAGAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021073.2-1832s1c1
Sequence:CCGGCCAGAAGGATACGCTGCATTTCTCGAGAAATGCAGCGTATCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1543s21c1
Sequence:CCGGTGGACGCAGTATCAACGTAAACTCGAGTTTACGTTGATACTGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021073.2-1896s21c1
Sequence:CCGGATGCCACCAACCACGCTATAGCTCGAGCTATAGCGTGGTTGGTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007555
BMP5 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1272s1c1
Sequence:CCGGCGGTTTGATCTGACCCAGATTCTCGAGAATCTGGGTCAGATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007555.2-2133s1c1
Sequence:CCGGGCTATGTTTATGACCACAATACTCGAGTATTGTGGTCATAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1518s1c1
Sequence:CCGGCCACAGAACAATTTGGGCTTACTCGAGTAAGCCCAAATTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-876s1c1
Sequence:CCGGCGGGAAATACAGAGGGAAATTCTCGAGAATTTCCCTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1707s1c1
Sequence:CCGGCGCAATAAATCCAACTCTCATCTCGAGATGAGAGTTGGATTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007555
BMP5 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1272s1c1
Sequence:CCGGCGGTTTGATCTGACCCAGATTCTCGAGAATCTGGGTCAGATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007555.2-2133s1c1
Sequence:CCGGGCTATGTTTATGACCACAATACTCGAGTATTGTGGTCATAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1518s1c1
Sequence:CCGGCCACAGAACAATTTGGGCTTACTCGAGTAAGCCCAAATTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-876s1c1
Sequence:CCGGCGGGAAATACAGAGGGAAATTCTCGAGAATTTCCCTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1707s1c1
Sequence:CCGGCGCAATAAATCCAACTCTCATCTCGAGATGAGAGTTGGATTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007555
BMP5 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1272s1c1
Sequence:CCGGCGGTTTGATCTGACCCAGATTCTCGAGAATCTGGGTCAGATCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007555.2-2133s1c1
Sequence:CCGGGCTATGTTTATGACCACAATACTCGAGTATTGTGGTCATAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1518s1c1
Sequence:CCGGCCACAGAACAATTTGGGCTTACTCGAGTAAGCCCAAATTGTTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-876s1c1
Sequence:CCGGCGGGAAATACAGAGGGAAATTCTCGAGAATTTCCCTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007555.2-1707s1c1
Sequence:CCGGCGCAATAAATCCAACTCTCATCTCGAGATGAGAGTTGGATTTATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks