EMAIL THIS PAGE TO A FRIEND

BMP6

bone morphogenetic protein 6

Synonyms: VGR VGR1
UniProtKB ID: P22004, Q5TCP3
Gene ID:
Human(654) Summary: The bone morphogenetic proteins (BMPs) are a family of secreted signaling molecules that can induce ectopic bone growth. Many BMPs are part of the transforming growth factor-beta (TGFB) superfamily. BMPs were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. Based on its expression early in embryogenesis, the BMP encoded by this gene has a proposed role in early development. In addition, the fact that this BMP is closely related to BMP5 and BMP7 has lead to speculation of possible bone inductive activity. [provided by RefSeq, Jul 2008]
Mouse(12161) bone morphogenetic protein 6
Rat(25644) bone morphogenetic protein 6
Zebrafish(503761) bone morphogenetic protein 6
dog(478715) bone morphogenetic protein 6
Horse(100033934) bone morphogenetic protein 6
cow(617566) bone morphogenetic protein 6
domestic cat(101098870) bone morphogenetic protein 6
chicken(420868) bone morphogenetic protein 6
Goat(100860793) bone morphogenetic protein 6
sheep(443174) bone morphogenetic protein 6
domestic guinea pig(100733783) bone morphogenetic protein 6
naked mole-rat(101707462) bone morphogenetic protein 6
Gene Class: Cytokines_and_Chemokines
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001718 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001718 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001718 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040491 MISSION® esiRNA esiRNA human BMP6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001718 siRNAs that have been validated in the lab human pricing
NM_013107 Rosetta Predictions rat pricing
NM_007556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001718 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032190 validated 1004
2 SASI_Hs02_00332417 predicted 1224
3 SASI_Hs01_00032191 predicted 1111
4 SASI_Hs01_00032192 predicted 1614
5 SASI_Hs01_00032193 predicted 1374
6 SASI_Hs01_00032194 predicted 1616
7 SASI_Hs01_00032195 predicted 1329
8 SASI_Hs01_00032196 predicted 936
9 SASI_Hs01_00032197 predicted 1096
10 SASI_Hs01_00032198 predicted 1483
11 SASI_Hs02_00332418 predicted 1524
12 SASI_Hs01_00032189 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260881 predicted 925
2 SASI_Rn01_00076329 predicted 731
3 SASI_Rn01_00076330 predicted 1126
4 SASI_Rn01_00076331 predicted 512
5 SASI_Rn02_00260882 predicted 375
6 SASI_Rn01_00076332 predicted 745
7 SASI_Rn02_00260883 predicted 1129
8 SASI_Rn01_00076333 predicted 894
9 SASI_Rn01_00076335 predicted 1182
10 SASI_Rn01_00076337 predicted 209
11 SASI_Rn01_00076334 predicted 1210
12 SASI_Rn01_00076336 predicted 680
13 SASI_Rn01_00076338 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311919 predicted 1786
2 SASI_Mm01_00139828 predicted 907
3 SASI_Mm01_00139830 predicted 804
4 SASI_Mm01_00139831 predicted 1434
5 SASI_Mm01_00139833 predicted 1407
6 SASI_Mm01_00139834 predicted 1257
7 SASI_Mm01_00139835 predicted 1126
8 SASI_Mm02_00311920 predicted 1827
9 SASI_Mm02_00311921 predicted 1125
10 SASI_Mm02_00311922 predicted 1139
11 SASI_Mm01_00139827 predicted 913
12 SASI_Mm01_00139829 predicted 1665
13 SASI_Mm01_00139832 predicted 1012
14 SASI_Mm01_00139836 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001718
BMP6 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1054s21c1
Sequence:CCGGGTTGGACACCCGTGTAGTATGCTCGAGCATACTACACGGGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1681s21c1
Sequence:CCGGATACAGGAATATGGTTGTAAGCTCGAGCTTACAACCATATTCCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001718.4-2133s21c1
Sequence:CCGGCTGTCTATCAAAGGTAGATTTCTCGAGAAATCTACCTTTGATAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1316s21c1
Sequence:CCGGCGCCGACAACAGAGTCGTAATCTCGAGATTACGACTCTGTTGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1561s21c1
Sequence:CCGGGCAGACCTTGGTTCACCTTATCTCGAGATAAGGTGAACCAAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-948s1c1
Sequence:CCGGCGCATCTACAAGGACTGTGTTCTCGAGAACACAGTCCTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1421s1c1
Sequence:CCGGGCATGAGCTGTATGTGAGTTTCTCGAGAAACTCACATACAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1616s1c1
Sequence:CCGGGCCAACTAAGCTAAATGCCATCTCGAGATGGCATTTAGCTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-875s1c1
Sequence:CCGGGCGACACCACAAAGAGTTCAACTCGAGTTGAACTCTTTGTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1529s1c1
Sequence:CCGGCGCACACATGAATGCAACCAACTCGAGTTGGTTGCATTCATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001718
BMP6 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1054s21c1
Sequence:CCGGGTTGGACACCCGTGTAGTATGCTCGAGCATACTACACGGGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1681s21c1
Sequence:CCGGATACAGGAATATGGTTGTAAGCTCGAGCTTACAACCATATTCCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001718.4-2133s21c1
Sequence:CCGGCTGTCTATCAAAGGTAGATTTCTCGAGAAATCTACCTTTGATAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1316s21c1
Sequence:CCGGCGCCGACAACAGAGTCGTAATCTCGAGATTACGACTCTGTTGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1561s21c1
Sequence:CCGGGCAGACCTTGGTTCACCTTATCTCGAGATAAGGTGAACCAAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-948s1c1
Sequence:CCGGCGCATCTACAAGGACTGTGTTCTCGAGAACACAGTCCTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1421s1c1
Sequence:CCGGGCATGAGCTGTATGTGAGTTTCTCGAGAAACTCACATACAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1616s1c1
Sequence:CCGGGCCAACTAAGCTAAATGCCATCTCGAGATGGCATTTAGCTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-875s1c1
Sequence:CCGGGCGACACCACAAAGAGTTCAACTCGAGTTGAACTCTTTGTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1529s1c1
Sequence:CCGGCGCACACATGAATGCAACCAACTCGAGTTGGTTGCATTCATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001718
BMP6 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1054s21c1
Sequence:CCGGGTTGGACACCCGTGTAGTATGCTCGAGCATACTACACGGGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1681s21c1
Sequence:CCGGATACAGGAATATGGTTGTAAGCTCGAGCTTACAACCATATTCCTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427881    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001718.4-2133s21c1
Sequence:CCGGCTGTCTATCAAAGGTAGATTTCTCGAGAAATCTACCTTTGATAGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1316s21c1
Sequence:CCGGCGCCGACAACAGAGTCGTAATCTCGAGATTACGACTCTGTTGTCGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001718.4-1561s21c1
Sequence:CCGGGCAGACCTTGGTTCACCTTATCTCGAGATAAGGTGAACCAAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-948s1c1
Sequence:CCGGCGCATCTACAAGGACTGTGTTCTCGAGAACACAGTCCTTGTAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1421s1c1
Sequence:CCGGGCATGAGCTGTATGTGAGTTTCTCGAGAAACTCACATACAGCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1616s1c1
Sequence:CCGGGCCAACTAAGCTAAATGCCATCTCGAGATGGCATTTAGCTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-875s1c1
Sequence:CCGGGCGACACCACAAAGAGTTCAACTCGAGTTGAACTCTTTGTGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001718.2-1529s1c1
Sequence:CCGGCGCACACATGAATGCAACCAACTCGAGTTGGTTGCATTCATGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007556
BMP6 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1112s21c1
Sequence:CCGGGAAGAAGGTTGGCTGGAATTTCTCGAGAAATTCCAGCCAACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1730s21c1
Sequence:CCGGAGAGCTTGTGGTTGCCATTAACTCGAGTTAATGGCAACCACAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007556.1-1945s1c1
Sequence:CCGGCCAGTTCCTAACTGAGCAGTTCTCGAGAACTGCTCAGTTAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1602s1c1
Sequence:CCGGCCACCTTATGAATCCCGAGTACTCGAGTACTCGGGATTCATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1667s1c1
Sequence:CCGGCGGTTCTTTACTTCGATGATACTCGAGTATCATCGAAGTAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1059s1c1
Sequence:CCGGGCACAGAGACTCTGACCTATTCTCGAGAATAGGTCAGAGTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-909s1c1
Sequence:CCGGCCACAAAGAGTTCAAGTTCAACTCGAGTTGAACTTGAACTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007556
BMP6 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1112s21c1
Sequence:CCGGGAAGAAGGTTGGCTGGAATTTCTCGAGAAATTCCAGCCAACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1730s21c1
Sequence:CCGGAGAGCTTGTGGTTGCCATTAACTCGAGTTAATGGCAACCACAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007556.1-1945s1c1
Sequence:CCGGCCAGTTCCTAACTGAGCAGTTCTCGAGAACTGCTCAGTTAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1602s1c1
Sequence:CCGGCCACCTTATGAATCCCGAGTACTCGAGTACTCGGGATTCATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1667s1c1
Sequence:CCGGCGGTTCTTTACTTCGATGATACTCGAGTATCATCGAAGTAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1059s1c1
Sequence:CCGGGCACAGAGACTCTGACCTATTCTCGAGAATAGGTCAGAGTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-909s1c1
Sequence:CCGGCCACAAAGAGTTCAAGTTCAACTCGAGTTGAACTTGAACTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007556
BMP6 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1112s21c1
Sequence:CCGGGAAGAAGGTTGGCTGGAATTTCTCGAGAAATTCCAGCCAACCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007556.2-1730s21c1
Sequence:CCGGAGAGCTTGTGGTTGCCATTAACTCGAGTTAATGGCAACCACAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007556.1-1945s1c1
Sequence:CCGGCCAGTTCCTAACTGAGCAGTTCTCGAGAACTGCTCAGTTAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1602s1c1
Sequence:CCGGCCACCTTATGAATCCCGAGTACTCGAGTACTCGGGATTCATAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1667s1c1
Sequence:CCGGCGGTTCTTTACTTCGATGATACTCGAGTATCATCGAAGTAAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-1059s1c1
Sequence:CCGGGCACAGAGACTCTGACCTATTCTCGAGAATAGGTCAGAGTCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007556.1-909s1c1
Sequence:CCGGCCACAAAGAGTTCAAGTTCAACTCGAGTTGAACTTGAACTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks