EMAIL THIS PAGE TO A FRIEND

BMP7

bone morphogenetic protein 7

88 Gene Product Result for
Synonyms: OP-1
UniProtKB ID: P18075, Q9H512, Q9NTQ7
Gene ID:
Human(655) Summary: The bone morphogenetic proteins (BMPs) are a family of secreted signaling molecules that can induce ectopic bone growth. Many BMPs are part of the transforming growth factor-beta (TGFB) superfamily. BMPs were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. Based on its expression early in embryogenesis, the BMP encoded by this gene has a proposed role in early development and possible bone inductive activity. [provided by RefSeq, Jul 2008]
Mouse(12162) bone morphogenetic protein 7
Rat(85272) bone morphogenetic protein 7
chicken(395494) bone morphogenetic protein 7
dog(477270) bone morphogenetic protein 7
Horse(100050299) bone morphogenetic protein 7
cow(540595) bone morphogenetic protein 7
naked mole-rat(101706196) bone morphogenetic protein 7
domestic guinea pig(100725543) bone morphogenetic protein 7
sheep(443175) bone morphogenetic protein 7
Domestic Rabbit(100008826) bone morphogenetic protein 7
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B1688 Anti-BMP7 (303-315) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405519 Anti-BMP7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107883 Anti-BMP7 antibody produced in rabbit IgG fraction of antiserum zebrafish, sheep, human, horse, guinea pig, rat, pig, rabbit, mouse, canine, bovine
immunohistochemistry, western blot pricing
SAB2106257 Anti-BMP7 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, rat, human
ELISA, western blot pricing
HPA057757 Anti-BMP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0000655M1 Monoclonal Anti-BMP7 antibody produced in mouse clone M1-F8, purified immunoglobulin, buffered aqueous solution mouse
ELISA, western blot pricing
SAB1403611 Monoclonal Anti-BMP7 antibody produced in mouse clone S52, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1409674 Monoclonal Anti-BMP7 antibody produced in mouse clone 2D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409675 Monoclonal Anti-BMP7 antibody produced in mouse clone 1H3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409676 Monoclonal Anti-BMP7 antibody produced in mouse clone 1F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409677 Monoclonal Anti-BMP7 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001719 Rosetta Predictions human pricing
XM_001053727 Rosetta Predictions rat pricing
XM_342591 Rosetta Predictions rat pricing
NM_007557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079814 predicted 1140
2 SASI_Hs02_00332419 predicted 1043
3 SASI_Hs01_00079815 predicted 1226
4 SASI_Hs01_00079816 predicted 988
5 SASI_Hs01_00079817 predicted 1743
6 SASI_Hs01_00079819 predicted 927
7 SASI_Hs01_00079820 predicted 758
8 SASI_Hs01_00079821 predicted 970
9 SASI_Hs02_00332420 predicted 2286
10 SASI_Hs01_00079822 predicted 1222
11 SASI_Hs01_00079818 predicted 634
12 SASI_Hs01_00079823 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273370 predicted 1472
2 SASI_Rn02_00273371 predicted 502
3 SASI_Rn02_00273372 predicted 434
4 SASI_Rn02_00273373 predicted 1470
5 SASI_Rn02_00273374 predicted 692
6 SASI_Rn02_00273375 predicted 709
7 SASI_Rn02_00273376 predicted 994
8 SASI_Rn02_00273377 predicted 780
9 SASI_Rn02_00273378 predicted 792
10 SASI_Rn02_00273379 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394519 predicted 416
2 SASI_Rn02_00394520 predicted 428
3 SASI_Rn02_00394521 predicted 498
4 SASI_Rn02_00394522 predicted 412
5 SASI_Rn02_00394523 predicted 364
6 SASI_Rn02_00394524 predicted 346
7 SASI_Rn02_00394525 predicted 501
8 SASI_Rn02_00394526 predicted 432
9 SASI_Rn02_00394527 predicted 432
10 SASI_Rn02_00394528 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034471 predicted 733
2 SASI_Mm01_00034472 predicted 1048
3 SASI_Mm01_00034473 predicted 306
4 SASI_Mm01_00034474 predicted 1553
5 SASI_Mm01_00034475 predicted 1545
6 SASI_Mm01_00034476 predicted 688
7 SASI_Mm01_00034477 predicted 1261
8 SASI_Mm01_00034478 predicted 1439
9 SASI_Mm01_00034479 predicted 1364
10 SASI_Mm01_00034480 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001719
VALIDATED
BMP7 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-644s1c1
Sequence:CCGGCCGGATCTACAAGGACTACATCTCGAGATGTAGTCCTTGTAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-590s1c1
Sequence:CCGGCCGGTTTGATCTTTCCAAGATCTCGAGATCTTGGAAAGATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1158s1c1
Sequence:CCGGGACTGGATCATCGCGCCTGAACTCGAGTTCAGGCGCGATGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-539s1c1
Sequence:CCGGCGTGGAACATGACAAGGAATTCTCGAGAATTCCTTGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1217s1c1
Sequence:CCGGCCCTCTGAACTCCTACATGAACTCGAGTTCATGTAGGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001719.2-693s21c1
Sequence:CCGGAGCGCGAGATCCTCTCCATTTCTCGAGAAATGGAGAGGATCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-984s21c1
Sequence:CCGGACCATCGAGAGTTCCGGTTTGCTCGAGCAAACCGGAACTCTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-2130s21c1
Sequence:GTACCGGACTCGTTTCCAGAGGTAATTACTCGAGTAATTACCTCTGGAAACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-1094s21c1
Sequence:CCGGACGTTCCGGATCAGCGTTTATCTCGAGATAAACGCTGATCCGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-886s21c1
Sequence:CCGGCAGCCTGCAAGATAGCCATTTCTCGAGAAATGGCTATCTTGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001719
VALIDATED
BMP7 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-644s1c1
Sequence:CCGGCCGGATCTACAAGGACTACATCTCGAGATGTAGTCCTTGTAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-590s1c1
Sequence:CCGGCCGGTTTGATCTTTCCAAGATCTCGAGATCTTGGAAAGATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1158s1c1
Sequence:CCGGGACTGGATCATCGCGCCTGAACTCGAGTTCAGGCGCGATGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-539s1c1
Sequence:CCGGCGTGGAACATGACAAGGAATTCTCGAGAATTCCTTGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1217s1c1
Sequence:CCGGCCCTCTGAACTCCTACATGAACTCGAGTTCATGTAGGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001719.2-693s21c1
Sequence:CCGGAGCGCGAGATCCTCTCCATTTCTCGAGAAATGGAGAGGATCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-984s21c1
Sequence:CCGGACCATCGAGAGTTCCGGTTTGCTCGAGCAAACCGGAACTCTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-2130s21c1
Sequence:GTACCGGACTCGTTTCCAGAGGTAATTACTCGAGTAATTACCTCTGGAAACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-1094s21c1
Sequence:CCGGACGTTCCGGATCAGCGTTTATCTCGAGATAAACGCTGATCCGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-886s21c1
Sequence:CCGGCAGCCTGCAAGATAGCCATTTCTCGAGAAATGGCTATCTTGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001719
VALIDATED
BMP7 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-644s1c1
Sequence:CCGGCCGGATCTACAAGGACTACATCTCGAGATGTAGTCCTTGTAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-590s1c1
Sequence:CCGGCCGGTTTGATCTTTCCAAGATCTCGAGATCTTGGAAAGATCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1158s1c1
Sequence:CCGGGACTGGATCATCGCGCCTGAACTCGAGTTCAGGCGCGATGATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001719.1-539s1c1
Sequence:CCGGCGTGGAACATGACAAGGAATTCTCGAGAATTCCTTGTCATGTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001719.1-1217s1c1
Sequence:CCGGCCCTCTGAACTCCTACATGAACTCGAGTTCATGTAGGAGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001719.2-693s21c1
Sequence:CCGGAGCGCGAGATCCTCTCCATTTCTCGAGAAATGGAGAGGATCTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-984s21c1
Sequence:CCGGACCATCGAGAGTTCCGGTTTGCTCGAGCAAACCGGAACTCTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218145    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-2130s21c1
Sequence:GTACCGGACTCGTTTCCAGAGGTAATTACTCGAGTAATTACCTCTGGAAACGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-1094s21c1
Sequence:CCGGACGTTCCGGATCAGCGTTTATCTCGAGATAAACGCTGATCCGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001719.2-886s21c1
Sequence:CCGGCAGCCTGCAAGATAGCCATTTCTCGAGAAATGGCTATCTTGCAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007557
VALIDATED
BMP7 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-770s1c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1313s1c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-390s1c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1448s1c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-732s1c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-390s21c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1448s21c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-732s21c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-770s21c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1313s21c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007557
VALIDATED
BMP7 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-770s1c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1313s1c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-390s1c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1448s1c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-732s1c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-390s21c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1448s21c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-732s21c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-770s21c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1313s21c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007557
VALIDATED
BMP7 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-770s1c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1313s1c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-390s1c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-1448s1c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007557.2-732s1c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-390s21c1
Sequence:CCGGCGGGAGATCCTGTCCATCTTACTCGAGTAAGATGGACAGGATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1448s21c1
Sequence:CCGGCGACGACAGCTCTAATGTCATCTCGAGATGACATTAGAGCTGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-732s21c1
Sequence:CCGGGCAGCCGAATTCAGGATCTATCTCGAGATAGATCCTGAATTCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-770s21c1
Sequence:CCGGGCGATTTGACAACGAGACCTTCTCGAGAAGGTCTCGTTGTCAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007557.2-1313s21c1
Sequence:CCGGCTTCCCTCTGAACTCCTACATCTCGAGATGTAGGAGTTCAGAGGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks