EMAIL THIS PAGE TO A FRIEND

BMP8A

bone morphogenetic protein 8a

69 Gene Product Result for
UniProtKB ID: Q7Z5Y6, Q5T3A5
Gene ID:
Mouse(12163) bone morphogenetic protein 8a
Rat(680931) bone morphogenetic protein 8a
Zebrafish(561963) bone morphogenetic protein 8a
cow(788948) bone morphogenetic protein 8a
naked mole-rat(101729531) bone morphogenetic protein 8a
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700395 Anti-BMP8A (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
SAB4300762 Anti-BMP8A antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4501530 Anti-BMP8A, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1289 Human BMP-8 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181809 Rosetta Predictions human pricing
NM_001109432 Rosetta Predictions rat pricing
NM_007558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049155 predicted 1823
2 SASI_Hs01_00049156 predicted 1820
3 SASI_Hs01_00049158 predicted 1663
4 SASI_Hs01_00049159 predicted 1803
5 SASI_Hs01_00049160 predicted 1671
6 SASI_Hs01_00049161 predicted 1695
7 SASI_Hs01_00049162 predicted 1814
8 SASI_Hs01_00049163 predicted 1745
9 SASI_Hs01_00049164 predicted 1734
10 SASI_Hs02_00370417 predicted 1865
11 SASI_Hs01_00049157 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248347 predicted 1369
2 SASI_Rn02_00248348 predicted 478
3 SASI_Rn02_00248349 predicted 477
4 SASI_Rn02_00248350 predicted 1380
5 SASI_Rn02_00248351 predicted 948
6 SASI_Rn02_00248352 predicted 1661
7 SASI_Rn02_00248353 predicted 1328
8 SASI_Rn02_00248354 predicted 1661
9 SASI_Rn02_00248355 predicted 1653
10 SASI_Rn02_00248356 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311923 predicted 1639
2 SASI_Mm01_00172684 predicted 1623
3 SASI_Mm01_00172679 predicted 1190
4 SASI_Mm01_00172681 predicted 1229
5 SASI_Mm01_00172682 predicted 1305
6 SASI_Mm01_00172683 predicted 311
7 SASI_Mm02_00311924 predicted 1351
8 SASI_Mm01_00172687 predicted 1624
9 SASI_Mm01_00172688 predicted 1653
10 SASI_Mm01_00172685 predicted 1628
11 SASI_Mm01_00172680 predicted 1356
12 SASI_Mm01_00172686 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181809
BMP8A MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 8a
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-2036s21c1
Sequence:CCGGAGGGTGCAGTTAGCATATTAGCTCGAGCTAATATGCTAACTGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1821s21c1
Sequence:CCGGAGCACAGAAGTCCTATCTTAGCTCGAGCTAAGATAGGACTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1950s21c1
Sequence:CCGGAGGTACAACACTGGCCATTTCCTCGAGGAAATGGCCAGTGTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1312s1c1
Sequence:CCGGCCAAGGCTACTCAGCCTATTACTCGAGTAATAGGCTGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1477s1c1
Sequence:CCGGGCTCTACTATGACAGCAGCAACTCGAGTTGCTGCTGTCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-716s1c1
Sequence:CCGGCATTGGAAGGAGTTCCGCTTTCTCGAGAAAGCGGAACTCCTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1516s1c1
Sequence:CCGGGCACCGCAACATGGTGGTCAACTCGAGTTGACCACCATGTTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-869s1c1
Sequence:CCGGAGGGAGTCTGACTTGTTCTTTCTCGAGAAAGAACAAGTCAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181809
BMP8A MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 8a
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-2036s21c1
Sequence:CCGGAGGGTGCAGTTAGCATATTAGCTCGAGCTAATATGCTAACTGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1821s21c1
Sequence:CCGGAGCACAGAAGTCCTATCTTAGCTCGAGCTAAGATAGGACTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1950s21c1
Sequence:CCGGAGGTACAACACTGGCCATTTCCTCGAGGAAATGGCCAGTGTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1312s1c1
Sequence:CCGGCCAAGGCTACTCAGCCTATTACTCGAGTAATAGGCTGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1477s1c1
Sequence:CCGGGCTCTACTATGACAGCAGCAACTCGAGTTGCTGCTGTCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-716s1c1
Sequence:CCGGCATTGGAAGGAGTTCCGCTTTCTCGAGAAAGCGGAACTCCTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1516s1c1
Sequence:CCGGGCACCGCAACATGGTGGTCAACTCGAGTTGACCACCATGTTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-869s1c1
Sequence:CCGGAGGGAGTCTGACTTGTTCTTTCTCGAGAAAGAACAAGTCAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181809
BMP8A MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 8a
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-2036s21c1
Sequence:CCGGAGGGTGCAGTTAGCATATTAGCTCGAGCTAATATGCTAACTGCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1821s21c1
Sequence:CCGGAGCACAGAAGTCCTATCTTAGCTCGAGCTAAGATAGGACTTCTGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181809.3-1950s21c1
Sequence:CCGGAGGTACAACACTGGCCATTTCCTCGAGGAAATGGCCAGTGTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1312s1c1
Sequence:CCGGCCAAGGCTACTCAGCCTATTACTCGAGTAATAGGCTGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1477s1c1
Sequence:CCGGGCTCTACTATGACAGCAGCAACTCGAGTTGCTGCTGTCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-716s1c1
Sequence:CCGGCATTGGAAGGAGTTCCGCTTTCTCGAGAAAGCGGAACTCCTTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-1516s1c1
Sequence:CCGGGCACCGCAACATGGTGGTCAACTCGAGTTGACCACCATGTTGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181809.1-869s1c1
Sequence:CCGGAGGGAGTCTGACTTGTTCTTTCTCGAGAAAGAACAAGTCAGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007558
BMP8A MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 8a
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1244s1c1
Sequence:CCGGCCTGCGTAAACACCGTAACATCTCGAGATGTTACGGTGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1146s1c1
Sequence:CCGGCACCTGATGAAGCCAGATGTTCTCGAGAACATCTGGCTTCATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-815s1c1
Sequence:CCGGACAGCCTTTCATGGTAACCTTCTCGAGAAGGTTACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-211s1c1
Sequence:CCGGGCCGCGACATGCAGCGTGAAACTCGAGTTTCACGCTGCATGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1253s1c1
Sequence:CCGGACACCGTAACATGGTGGTCAACTCGAGTTGACCACCATGTTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007558
BMP8A MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 8a
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1244s1c1
Sequence:CCGGCCTGCGTAAACACCGTAACATCTCGAGATGTTACGGTGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1146s1c1
Sequence:CCGGCACCTGATGAAGCCAGATGTTCTCGAGAACATCTGGCTTCATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-815s1c1
Sequence:CCGGACAGCCTTTCATGGTAACCTTCTCGAGAAGGTTACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-211s1c1
Sequence:CCGGGCCGCGACATGCAGCGTGAAACTCGAGTTTCACGCTGCATGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1253s1c1
Sequence:CCGGACACCGTAACATGGTGGTCAACTCGAGTTGACCACCATGTTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007558
BMP8A MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 8a
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1244s1c1
Sequence:CCGGCCTGCGTAAACACCGTAACATCTCGAGATGTTACGGTGTTTACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1146s1c1
Sequence:CCGGCACCTGATGAAGCCAGATGTTCTCGAGAACATCTGGCTTCATCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-815s1c1
Sequence:CCGGACAGCCTTTCATGGTAACCTTCTCGAGAAGGTTACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-211s1c1
Sequence:CCGGGCCGCGACATGCAGCGTGAAACTCGAGTTTCACGCTGCATGTCGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007558.1-1253s1c1
Sequence:CCGGACACCGTAACATGGTGGTCAACTCGAGTTGACCACCATGTTACGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks