EMAIL THIS PAGE TO A FRIEND

BMP8B

bone morphogenetic protein 8b

Synonyms: BMP8 OP2
UniProtKB ID: P34820, Q53ZM7, Q9NUF0
Gene ID:
Human(656) Summary: The bone morphogenetic proteins (BMPs) are a family of secreted signaling molecules that can induce ectopic bone growth. Many BMPs are part of the transforming growth factor-beta (TGFB) superfamily. BMPs were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. Based on its expression early in embryogenesis, the BMP encoded by this gene has a proposed role in early development. In addition, the fact that this BMP is closely related to BMP5 and BMP7 has led to speculation of possible bone inductive activity. [provided by RefSeq, Jul 2008]
Mouse(12164) bone morphogenetic protein 8b
Rat(679119) bone morphogenetic protein 8b
sheep(101120626) bone morphogenetic protein 8b
chicken(771058) bone morphogenetic protein 8b
cow(100296238) bone morphogenetic protein 8b
dog(607768) bone morphogenetic protein 8b
Gene Class: Cytokines_and_Chemokines
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP6322 BMP8B human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU084961 MISSION® esiRNA esiRNA targeting mouse Bmp8b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001720 Rosetta Predictions human pricing
XM_001054775 Rosetta Predictions rat pricing
NM_007559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157751 predicted 1810
2 SASI_Hs01_00157752 predicted 1913
3 SASI_Hs01_00157753 predicted 1690
4 SASI_Hs01_00157754 predicted 1765
5 SASI_Hs01_00157755 predicted 1961
6 SASI_Hs01_00157756 predicted 1850
7 SASI_Hs01_00157757 predicted 1918
8 SASI_Hs01_00157758 predicted 1703
9 SASI_Hs01_00157759 predicted 1969
10 SASI_Hs01_00157760 predicted 1975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277149 predicted 835
2 SASI_Rn02_00277150 predicted 992
3 SASI_Rn02_00277151 predicted 727
4 SASI_Rn02_00277152 predicted 1121
5 SASI_Rn02_00277153 predicted 800
6 SASI_Rn02_00277154 predicted 298
7 SASI_Rn02_00277155 predicted 1108
8 SASI_Rn02_00277156 predicted 1026
9 SASI_Rn02_00277157 predicted 1106
10 SASI_Rn02_00277158 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109466 predicted 399
2 SASI_Mm01_00109467 predicted 1309
3 SASI_Mm01_00109468 predicted 477
4 SASI_Mm01_00109469 predicted 1020
5 SASI_Mm02_00311925 predicted 1055
6 SASI_Mm01_00109471 predicted 1297
7 SASI_Mm01_00109472 predicted 1212
8 SASI_Mm01_00109473 predicted 1295
9 SASI_Mm01_00109474 predicted 1471
10 SASI_Mm01_00109475 predicted 1019
11 SASI_Mm01_00109470 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001720
BMP8B MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 8b
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001720.3-2910s1c1
Sequence:CCGGCCTGTAATTTACCTGCTGGAACTCGAGTTCCAGCAGGTAAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1510s1c1
Sequence:CCGGCTACTATGACAGCAGCAACAACTCGAGTTGTTGCTGCTGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1496s1c1
Sequence:CCGGGCCACCTCTGTGCTCTACTATCTCGAGATAGTAGAGCACAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1342s1c1
Sequence:CCGGCCAAGGCTACTCGGCCTATTACTCGAGTAATAGGCCGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-745s1c1
Sequence:CCGGCCATTGGAAGGAGTTCCGCTTCTCGAGAAGCGGAACTCCTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001720.3-1696s21c1
Sequence:CCGGGACCCTCACAACCACGTACATCTCGAGATGTACGTGGTTGTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001720.3-700s21c1
Sequence:CCGGCGTTAACATGGTGGAGCGAGACTCGAGTCTCGCTCCACCATGTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001720
BMP8B MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 8b
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001720.3-2910s1c1
Sequence:CCGGCCTGTAATTTACCTGCTGGAACTCGAGTTCCAGCAGGTAAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1510s1c1
Sequence:CCGGCTACTATGACAGCAGCAACAACTCGAGTTGTTGCTGCTGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1496s1c1
Sequence:CCGGGCCACCTCTGTGCTCTACTATCTCGAGATAGTAGAGCACAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1342s1c1
Sequence:CCGGCCAAGGCTACTCGGCCTATTACTCGAGTAATAGGCCGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-745s1c1
Sequence:CCGGCCATTGGAAGGAGTTCCGCTTCTCGAGAAGCGGAACTCCTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001720.3-1696s21c1
Sequence:CCGGGACCCTCACAACCACGTACATCTCGAGATGTACGTGGTTGTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001720.3-700s21c1
Sequence:CCGGCGTTAACATGGTGGAGCGAGACTCGAGTCTCGCTCCACCATGTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001720
BMP8B MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 8b
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001720.3-2910s1c1
Sequence:CCGGCCTGTAATTTACCTGCTGGAACTCGAGTTCCAGCAGGTAAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1510s1c1
Sequence:CCGGCTACTATGACAGCAGCAACAACTCGAGTTGTTGCTGCTGTCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1496s1c1
Sequence:CCGGGCCACCTCTGTGCTCTACTATCTCGAGATAGTAGAGCACAGAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-1342s1c1
Sequence:CCGGCCAAGGCTACTCGGCCTATTACTCGAGTAATAGGCCGAGTAGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001720.3-745s1c1
Sequence:CCGGCCATTGGAAGGAGTTCCGCTTCTCGAGAAGCGGAACTCCTTCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001720.3-1696s21c1
Sequence:CCGGGACCCTCACAACCACGTACATCTCGAGATGTACGTGGTTGTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001720.3-700s21c1
Sequence:CCGGCGTTAACATGGTGGAGCGAGACTCGAGTCTCGCTCCACCATGTTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007559
VALIDATED
BMP8B MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein 8b
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-2136s1c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-910s1c1
Sequence:CCGGACAGCCTTTCATGGTTGGTTTCTCGAGAAACCAACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-913s1c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-482s1c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-1309s1c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007559.4-2134s21c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-912s21c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-481s21c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-1308s21c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007559
VALIDATED
BMP8B MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein 8b
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-2136s1c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-910s1c1
Sequence:CCGGACAGCCTTTCATGGTTGGTTTCTCGAGAAACCAACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-913s1c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-482s1c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-1309s1c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007559.4-2134s21c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-912s21c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-481s21c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-1308s21c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007559
VALIDATED
BMP8B MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein 8b
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098050    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-2136s1c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-910s1c1
Sequence:CCGGACAGCCTTTCATGGTTGGTTTCTCGAGAAACCAACCATGAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-913s1c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007559.2-482s1c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007559.2-1309s1c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007559.4-2134s21c1
Sequence:CCGGCGGATTTATCATCTGGATTTACTCGAGTAAATCCAGATGATAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-912s21c1
Sequence:CCGGGCCTTTCATGGTTGGTTTCTTCTCGAGAAGAAACCAACCATGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-481s21c1
Sequence:CCGGGCTGACCTGATTATGAGCTTTCTCGAGAAAGCTCATAATCAGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007559.4-1308s21c1
Sequence:CCGGGCTCTACTATGATAGAAACAACTCGAGTTGTTTCTATCATAGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks