EMAIL THIS PAGE TO A FRIEND

BMPER

BMP binding endothelial regulator

170 Gene Product Result for
Synonyms: CRIM3 CV-2 CV2
UniProtKB ID: Q8N8U9, A8K1P8, Q8TF36
Gene ID:
Human(168667) Summary: This gene encodes a secreted protein that interacts with, and inhibits bone morphogenetic protein (BMP) function. It has been shown to inhibit BMP2- and BMP4-dependent osteoblast differentiation and BMP-dependent differentiation of the chondrogenic cells. Mutations in this gene are associated with a lethal skeletal disorder, diaphanospondylodysostosis. [provided by RefSeq, Dec 2011]
Mouse(73230) BMP-binding endothelial regulator
Rat(300455) BMP-binding endothelial regulator
Zebrafish(338246) BMP binding endothelial regulator
chicken(420744) BMP binding endothelial regulator
cow(534101) BMP binding endothelial regulator
Horse(100070275) BMP binding endothelial regulator
domestic cat(101092594) BMP binding endothelial regulator
dog(475280) BMP binding endothelial regulator
sheep(101118437) BMP binding endothelial regulator
Domestic Rabbit(100349327) BMP binding endothelial regulator
domestic guinea pig(100723642) BMP binding endothelial regulator
naked mole-rat(101717569) BMP binding endothelial regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV52569 Anti-BMPER antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, zebrafish, rat, horse, rabbit, bovine
western blot pricing
HPA018083 Anti-BMPER antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133468 Rosetta Predictions human pricing
XM_001053312 Rosetta Predictions rat pricing
XM_235962 Rosetta Predictions rat pricing
NM_028472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363165 predicted 2321
2 SASI_Hs01_00124387 predicted 1270
3 SASI_Hs01_00124388 predicted 1886
4 SASI_Hs01_00124391 predicted 553
5 SASI_Hs01_00124392 predicted 1302
6 SASI_Hs01_00124393 predicted 1847
7 SASI_Hs01_00124395 predicted 965
8 SASI_Hs01_00124396 predicted 952
9 SASI_Hs02_00363166 predicted 2207
10 SASI_Hs02_00363167 predicted 1081
11 SASI_Hs01_00124389 predicted 877
12 SASI_Hs01_00124390 predicted 1054
13 SASI_Hs01_00124394 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271924 predicted 1628
2 SASI_Rn02_00271925 predicted 2491
3 SASI_Rn02_00271926 predicted 1054
4 SASI_Rn02_00271927 predicted 2437
5 SASI_Rn02_00271928 predicted 2565
6 SASI_Rn02_00271929 predicted 912
7 SASI_Rn02_00271930 predicted 2208
8 SASI_Rn02_00271931 predicted 1435
9 SASI_Rn02_00271932 predicted 2042
10 SASI_Rn02_00271933 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389775 predicted 437
2 SASI_Rn02_00389776 predicted 1304
3 SASI_Rn02_00389777 predicted 1254
4 SASI_Rn02_00389778 predicted 1371
5 SASI_Rn02_00389779 predicted 1018
6 SASI_Rn02_00389780 predicted 254
7 SASI_Rn02_00389781 predicted 1019
8 SASI_Rn02_00389782 predicted 853
9 SASI_Rn02_00389783 predicted 1173
10 SASI_Rn02_00389784 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115826 predicted 2325
2 SASI_Mm01_00115827 predicted 747
3 SASI_Mm01_00115828 predicted 1459
4 SASI_Mm01_00115829 predicted 2271
5 SASI_Mm01_00115830 predicted 2236
6 SASI_Mm01_00115831 predicted 894
7 SASI_Mm02_00333922 predicted 1274
8 SASI_Mm01_00115833 predicted 1343
9 SASI_Mm01_00115834 predicted 1874
10 SASI_Mm02_00333923 predicted 1157
11 SASI_Mm01_00115825 predicted 1229
12 SASI_Mm01_00115832 predicted 2319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133468
BMPER MISSION shRNA Bacterial Glycerol Stock
BMP binding endothelial regulator
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1095s21c1
Sequence:CCGGCAGGACGGAGTGTCGCAATAACTCGAGTTATTGCGACACTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1049s21c1
Sequence:CCGGAGATGTGGTCCTCTATCAATTCTCGAGAATTGATAGAGGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-185s21c1
Sequence:CCGGGCGTCTTGCTGCTACTCAATTCTCGAGAATTGAGTAGCAGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133468.2-2504s1c1
Sequence:CCGGGCAGTATTTGTGTGCCCGATTCTCGAGAATCGGGCACACAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1094s1c1
Sequence:CCGGCGAAGTGATGTTTATGACAATCTCGAGATTGTCATAAACATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-802s1c1
Sequence:CCGGGCGCTGTGTTGTTCATTGTAACTCGAGTTACAATGAACAACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1087s1c1
Sequence:CCGGCCTCTTTCGAAGTGATGTTTACTCGAGTAAACATCACTTCGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1889s1c1
Sequence:CCGGGATGACTTAATTGGTGGAGATCTCGAGATCTCCACCAATTAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133468
BMPER MISSION shRNA shRNA Plasmid DNA
BMP binding endothelial regulator
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1095s21c1
Sequence:CCGGCAGGACGGAGTGTCGCAATAACTCGAGTTATTGCGACACTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1049s21c1
Sequence:CCGGAGATGTGGTCCTCTATCAATTCTCGAGAATTGATAGAGGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-185s21c1
Sequence:CCGGGCGTCTTGCTGCTACTCAATTCTCGAGAATTGAGTAGCAGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133468.2-2504s1c1
Sequence:CCGGGCAGTATTTGTGTGCCCGATTCTCGAGAATCGGGCACACAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1094s1c1
Sequence:CCGGCGAAGTGATGTTTATGACAATCTCGAGATTGTCATAAACATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-802s1c1
Sequence:CCGGGCGCTGTGTTGTTCATTGTAACTCGAGTTACAATGAACAACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1087s1c1
Sequence:CCGGCCTCTTTCGAAGTGATGTTTACTCGAGTAAACATCACTTCGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1889s1c1
Sequence:CCGGGATGACTTAATTGGTGGAGATCTCGAGATCTCCACCAATTAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133468
BMPER MISSION shRNA Lentiviral Transduction Particles
BMP binding endothelial regulator
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1095s21c1
Sequence:CCGGCAGGACGGAGTGTCGCAATAACTCGAGTTATTGCGACACTCCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-1049s21c1
Sequence:CCGGAGATGTGGTCCTCTATCAATTCTCGAGAATTGATAGAGGACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133468.3-185s21c1
Sequence:CCGGGCGTCTTGCTGCTACTCAATTCTCGAGAATTGAGTAGCAGCAAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133468.2-2504s1c1
Sequence:CCGGGCAGTATTTGTGTGCCCGATTCTCGAGAATCGGGCACACAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1094s1c1
Sequence:CCGGCGAAGTGATGTTTATGACAATCTCGAGATTGTCATAAACATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-802s1c1
Sequence:CCGGGCGCTGTGTTGTTCATTGTAACTCGAGTTACAATGAACAACACAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1087s1c1
Sequence:CCGGCCTCTTTCGAAGTGATGTTTACTCGAGTAAACATCACTTCGAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133468.2-1889s1c1
Sequence:CCGGGATGACTTAATTGGTGGAGATCTCGAGATCTCCACCAATTAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028472
BMPER MISSION shRNA Bacterial Glycerol Stock
BMP binding endothelial regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028472.1-3282s1c1
Sequence:CCGGCCTCATTACTTATGTGTGCAACTCGAGTTGCACACATAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2525s1c1
Sequence:CCGGCCATGCAATAAGCCCTGCATTCTCGAGAATGCAGGGCTTATTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-867s1c1
Sequence:CCGGGCTGTGAACGATGCAAAGGTTCTCGAGAACCTTTGCATCGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-1105s1c1
Sequence:CCGGGCCAGAAGGAAACAAATGTATCTCGAGATACATTTGTTTCCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2277s1c1
Sequence:CCGGGCCACTCTACAGTGGACTATACTCGAGTATAGTCCACTGTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028472
BMPER MISSION shRNA shRNA Plasmid DNA
BMP binding endothelial regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028472.1-3282s1c1
Sequence:CCGGCCTCATTACTTATGTGTGCAACTCGAGTTGCACACATAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2525s1c1
Sequence:CCGGCCATGCAATAAGCCCTGCATTCTCGAGAATGCAGGGCTTATTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-867s1c1
Sequence:CCGGGCTGTGAACGATGCAAAGGTTCTCGAGAACCTTTGCATCGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-1105s1c1
Sequence:CCGGGCCAGAAGGAAACAAATGTATCTCGAGATACATTTGTTTCCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2277s1c1
Sequence:CCGGGCCACTCTACAGTGGACTATACTCGAGTATAGTCCACTGTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028472
BMPER MISSION shRNA Lentiviral Transduction Particles
BMP binding endothelial regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114776    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028472.1-3282s1c1
Sequence:CCGGCCTCATTACTTATGTGTGCAACTCGAGTTGCACACATAAGTAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2525s1c1
Sequence:CCGGCCATGCAATAAGCCCTGCATTCTCGAGAATGCAGGGCTTATTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-867s1c1
Sequence:CCGGGCTGTGAACGATGCAAAGGTTCTCGAGAACCTTTGCATCGTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-1105s1c1
Sequence:CCGGGCCAGAAGGAAACAAATGTATCTCGAGATACATTTGTTTCCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028472.1-2277s1c1
Sequence:CCGGGCCACTCTACAGTGGACTATACTCGAGTATAGTCCACTGTAGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks