EMAIL THIS PAGE TO A FRIEND

BMPR1B

bone morphogenetic protein receptor, type IB

73 Gene Product Result for
Synonyms: ALK-6 ALK6 CDw293
UniProtKB ID: O00238, B2R953, B4DSV1, P78366
Gene ID:
Human(658) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(12167) bone morphogenetic protein receptor, type 1B
Rat(310914) bone morphogenetic protein receptor, type IB
chicken(396030) bone morphogenetic protein receptor, type IB
dog(478484) bone morphogenetic protein receptor, type IB
cow(407128) bone morphogenetic protein receptor, type IB
domestic cat(101082489) bone morphogenetic protein receptor, type IB
domestic guinea pig(100732675) bone morphogenetic protein receptor, type IB
naked mole-rat(101710196) bone morphogenetic protein receptor, type IB
sheep(443454) bone morphogenetic protein receptor, type IB
Domestic Rabbit(100351275) bone morphogenetic protein receptor, type IB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1259 Human ALK-6 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001203 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001203 Rosetta Predictions human pricing
NM_001024259 Rosetta Predictions rat pricing
NM_007560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085856 predicted 737
2 SASI_Hs01_00085857 predicted 783
3 SASI_Hs01_00085859 predicted 344
4 SASI_Hs02_00331341 predicted 1354
5 SASI_Hs01_00085860 predicted 587
6 SASI_Hs01_00085862 predicted 997
7 SASI_Hs02_00331342 predicted 1852
8 SASI_Hs01_00085863 predicted 1195
9 SASI_Hs01_00085864 predicted 386
10 SASI_Hs01_00085865 predicted 1456
11 SASI_Hs01_00085858 predicted 1339
12 SASI_Hs01_00085861 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202421 predicted 851
2 SASI_Rn01_00088088 predicted 771
3 SASI_Rn01_00088089 predicted 995
4 SASI_Rn01_00088090 predicted 375
5 SASI_Rn01_00088092 predicted 745
6 SASI_Rn01_00088093 predicted 1012
7 SASI_Rn01_00088094 predicted 1207
8 SASI_Rn01_00088095 predicted 469
9 SASI_Rn01_00088096 predicted 839
10 SASI_Rn01_00088097 predicted 632
11 SASI_Rn01_00088091 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021874 predicted 420
2 SASI_Mm01_00021875 predicted 558
3 SASI_Mm01_00021876 predicted 630
4 SASI_Mm01_00021877 predicted 774
5 SASI_Mm01_00021878 predicted 636
6 SASI_Mm01_00021880 predicted 682
7 SASI_Mm01_00021881 predicted 1721
8 SASI_Mm01_00021882 predicted 619
9 SASI_Mm01_00021883 predicted 1648
10 SASI_Mm02_00311926 predicted 1409
11 SASI_Mm01_00021879 predicted 649
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007560
BMPR1B MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type IB
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1072s21c1
Sequence:CCGGTTCCGAGAGACTGAGATATATCTCGAGATATATCTCAGTCTCTCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-607s21c1
Sequence:CCGGCCTCATCAAAGAAGATCAATTCTCGAGAATTGATCTTCTTTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1461s21c1
Sequence:CCGGGGTTGGCACCAAGCGCTATATCTCGAGATATAGCGCTTGGTGCCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-427s1c1
Sequence:CCGGCCCAAGATCCTACGTTGTAAACTCGAGTTTACAACGTAGGATCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-464s1c1
Sequence:CCGGCGGAAGACTCAGTCAACAATACTCGAGTATTGTTGACTGAGTCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1595s1c1
Sequence:CCGGCTGGAGGTATAGTGGAAGAATCTCGAGATTCTTCCACTATACCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1240s1c1
Sequence:CCGGGCAAAGTCCATGCTGAAGCTACTCGAGTAGCTTCAGCATGGACTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1503s1c1
Sequence:CCGGGAGCTTGAATAGAAACCATTTCTCGAGAAATGGTTTCTATTCAAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007560
BMPR1B MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type IB
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1072s21c1
Sequence:CCGGTTCCGAGAGACTGAGATATATCTCGAGATATATCTCAGTCTCTCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-607s21c1
Sequence:CCGGCCTCATCAAAGAAGATCAATTCTCGAGAATTGATCTTCTTTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1461s21c1
Sequence:CCGGGGTTGGCACCAAGCGCTATATCTCGAGATATAGCGCTTGGTGCCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-427s1c1
Sequence:CCGGCCCAAGATCCTACGTTGTAAACTCGAGTTTACAACGTAGGATCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-464s1c1
Sequence:CCGGCGGAAGACTCAGTCAACAATACTCGAGTATTGTTGACTGAGTCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1595s1c1
Sequence:CCGGCTGGAGGTATAGTGGAAGAATCTCGAGATTCTTCCACTATACCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1240s1c1
Sequence:CCGGGCAAAGTCCATGCTGAAGCTACTCGAGTAGCTTCAGCATGGACTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1503s1c1
Sequence:CCGGGAGCTTGAATAGAAACCATTTCTCGAGAAATGGTTTCTATTCAAGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007560
BMPR1B MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type IB
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1072s21c1
Sequence:CCGGTTCCGAGAGACTGAGATATATCTCGAGATATATCTCAGTCTCTCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-607s21c1
Sequence:CCGGCCTCATCAAAGAAGATCAATTCTCGAGAATTGATCTTCTTTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007560.3-1461s21c1
Sequence:CCGGGGTTGGCACCAAGCGCTATATCTCGAGATATAGCGCTTGGTGCCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-427s1c1
Sequence:CCGGCCCAAGATCCTACGTTGTAAACTCGAGTTTACAACGTAGGATCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-464s1c1
Sequence:CCGGCGGAAGACTCAGTCAACAATACTCGAGTATTGTTGACTGAGTCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1595s1c1
Sequence:CCGGCTGGAGGTATAGTGGAAGAATCTCGAGATTCTTCCACTATACCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1240s1c1
Sequence:CCGGGCAAAGTCCATGCTGAAGCTACTCGAGTAGCTTCAGCATGGACTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007560.3-1503s1c1
Sequence:CCGGGAGCTTGAATAGAAACCATTTCTCGAGAAATGGTTTCTATTCAAGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001203
VALIDATED
BMPR1B MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type IB
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001203.2-1880s21c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1645s21c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1512s21c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1424s21c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1879s1c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.1-1644s1c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-533s1c1
Sequence:CCGGCTCATCAAAGAAGATCAATTGCTCGAGCAATTGATCTTCTTTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-352s1c1
Sequence:CCGGCCAAAGGTCTTGCGTTGTAAACTCGAGTTTACAACGCAAGACCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001203.1-1804s1c1
Sequence:CCGGCTCTGCAGAAAGCCAACAGGTCTCGAGACCTGTTGGCTTTCTGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1511s1c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1852s1c1
Sequence:CCGGGACATCAAATAAGCATCCACACTCGAGTGTGGATGCTTATTTGATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1423s1c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1519s1c1
Sequence:CCGGTCAGGAGGTATAGTGGAAGAACTCGAGTTCTTCCACTATACCTCCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-742s1c1
Sequence:CCGGCCTCGATACAGCATTGGGTTACTCGAGTAACCCAATGCTGTATCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.x-423s1c1
Sequence:CCGGCGGATATTGTTTCACGATGATCTCGAGATCATCGTGAAACAATATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001203
VALIDATED
BMPR1B MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type IB
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001203.2-1880s21c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1645s21c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1512s21c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1424s21c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1879s1c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.1-1644s1c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-533s1c1
Sequence:CCGGCTCATCAAAGAAGATCAATTGCTCGAGCAATTGATCTTCTTTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-352s1c1
Sequence:CCGGCCAAAGGTCTTGCGTTGTAAACTCGAGTTTACAACGCAAGACCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001203.1-1804s1c1
Sequence:CCGGCTCTGCAGAAAGCCAACAGGTCTCGAGACCTGTTGGCTTTCTGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1511s1c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1852s1c1
Sequence:CCGGGACATCAAATAAGCATCCACACTCGAGTGTGGATGCTTATTTGATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1423s1c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1519s1c1
Sequence:CCGGTCAGGAGGTATAGTGGAAGAACTCGAGTTCTTCCACTATACCTCCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-742s1c1
Sequence:CCGGCCTCGATACAGCATTGGGTTACTCGAGTAACCCAATGCTGTATCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.x-423s1c1
Sequence:CCGGCGGATATTGTTTCACGATGATCTCGAGATCATCGTGAAACAATATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001203
VALIDATED
BMPR1B MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type IB
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001203.2-1880s21c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1645s21c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1512s21c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001203.2-1424s21c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1879s1c1
Sequence:CCGGGCCTTGAACATCGTCCTGCTTCTCGAGAAGCAGGACGATGTTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.1-1644s1c1
Sequence:CCGGGAGCAGTGATGAGTGTCTAAGCTCGAGCTTAGACACTCATCACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-533s1c1
Sequence:CCGGCTCATCAAAGAAGATCAATTGCTCGAGCAATTGATCTTCTTTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-352s1c1
Sequence:CCGGCCAAAGGTCTTGCGTTGTAAACTCGAGTTTACAACGCAAGACCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001203.1-1804s1c1
Sequence:CCGGCTCTGCAGAAAGCCAACAGGTCTCGAGACCTGTTGGCTTTCTGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.1-1511s1c1
Sequence:CCGGGATGTGTATCAGGAGGTATAGCTCGAGCTATACCTCCTGATACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1852s1c1
Sequence:CCGGGACATCAAATAAGCATCCACACTCGAGTGTGGATGCTTATTTGATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1423s1c1
Sequence:CCGGGACGAGAGCTTGAACAGAAATCTCGAGATTTCTGTTCAAGCTCTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-1519s1c1
Sequence:CCGGTCAGGAGGTATAGTGGAAGAACTCGAGTTCTTCCACTATACCTCCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001203.x-742s1c1
Sequence:CCGGCCTCGATACAGCATTGGGTTACTCGAGTAACCCAATGCTGTATCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001203.x-423s1c1
Sequence:CCGGCGGATATTGTTTCACGATGATCTCGAGATCATCGTGAAACAATATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)