EMAIL THIS PAGE TO A FRIEND

BMPR2

bone morphogenetic protein receptor, type II (serine/threonine kinase)

312 Gene Product Result for
Synonyms: BMPR-II BMPR3 BMR2 BRK-3 PPH1 T-ALK
UniProtKB ID: Q13873, Q16569, Q4ZG08, Q53SA5, Q585T8
Gene ID:
Human(659) Summary: This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, Jul 2008]
Mouse(12168) bone morphogenetic protein receptor, type II (serine/threonine kinase)
Rat(140590) bone morphogenetic protein receptor, type II (serine/threonine kinase)
chicken(374147) bone morphogenetic protein receptor, type II (serine/threonine kinase)
dog(478875) bone morphogenetic protein receptor, type II (serine/threonine kinase)
cow(407127) bone morphogenetic protein receptor, type II (serine/threonine kinase)
domestic cat(101096338) bone morphogenetic protein receptor, type II (serine/threonine kinase)
sheep(101103793) bone morphogenetic protein receptor, type II (serine/threonine kinase)
sheep(100294556) bone morphogenetic protein receptor, type II (serine/threonine kinase)
Domestic Rabbit(100350246) bone morphogenetic protein receptor, type II (serine/threonine kinase)
naked mole-rat(101701138) bone morphogenetic protein receptor, type II (serine/threonine kinase)
domestic guinea pig(100736232) bone morphogenetic protein receptor, type II (serine/threonine kinase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B1187 Anti-BMPR2 (631-645) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B1312 Anti-BMPR2 (836-850) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA017385 Anti-BMPR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411292 Anti-BMPR2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA049014 Anti-BMPR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
B9928 Anti-Bone Morphogenetic Protein Receptor 2 antibody produced in goat affinity isolated antibody, lyophilized powder human
ELISA, western blot pricing
SAB1302612 ANTI-MOUSE BMPR2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1403614 Monoclonal Anti-BMPR2 antibody produced in mouse clone 4G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300504 Monoclonal Anti-BMPR2 antibody produced in mouse clone 1F12, ascites fluid monkey, rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB5300505 Monoclonal Anti-BMPR2 antibody produced in mouse clone 3F6, ascites fluid human, monkey, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402129 Monoclonal Anti-BMPR2 antibody produced in mouse clone 4A2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007561 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007561 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007561 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001204 Rosetta Predictions human pricing
XM_001065181 Rosetta Predictions rat pricing
XM_217409 Rosetta Predictions rat pricing
NM_007561 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163956 predicted 2381
2 SASI_Hs01_00163957 predicted 1363
3 SASI_Hs01_00163958 predicted 1161
4 SASI_Hs01_00163959 predicted 1439
5 SASI_Hs01_00163960 predicted 944
6 SASI_Hs01_00163961 predicted 1942
7 SASI_Hs01_00163963 predicted 3378
8 SASI_Hs01_00163964 predicted 1498
9 SASI_Hs01_00163965 predicted 690
10 SASI_Hs02_00331343 predicted 3413
11 SASI_Hs01_00163962 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313151 predicted 2120
2 SASI_Rn02_00313152 predicted 1876
3 SASI_Rn02_00313153 predicted 2005
4 SASI_Rn02_00313154 predicted 2466
5 SASI_Rn02_00313155 predicted 1673
6 SASI_Rn02_00313156 predicted 2993
7 SASI_Rn02_00313157 predicted 1681
8 SASI_Rn02_00313158 predicted 2216
9 SASI_Rn02_00313159 predicted 2558
10 SASI_Rn02_00313160 predicted 1521
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377154 predicted 1214
2 SASI_Rn02_00377155 predicted 970
3 SASI_Rn02_00377156 predicted 1100
4 SASI_Rn02_00377157 predicted 769
5 SASI_Rn02_00377158 predicted 2059
6 SASI_Rn02_00377159 predicted 778
7 SASI_Rn02_00377160 predicted 1312
8 SASI_Rn02_00377161 predicted 1451
9 SASI_Rn02_00377162 predicted 619
10 SASI_Rn02_00377163 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007561 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161530 predicted 1761
2 SASI_Mm01_00161532 predicted 1241
3 SASI_Mm01_00161533 predicted 1037
4 SASI_Mm02_00311927 predicted 2693
5 SASI_Mm01_00161534 predicted 776
6 SASI_Mm01_00161535 predicted 296
7 SASI_Mm01_00161536 predicted 645
8 SASI_Mm01_00161537 predicted 988
9 SASI_Mm01_00161538 predicted 2863
10 SASI_Mm01_00161539 predicted 432
11 SASI_Mm01_00161531 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007561
VALIDATED
BMPR2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-2381s1c1
Sequence:CCGGGCCAAGATGAATACAATCAATCTCGAGATTGATTGTATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-440s1c1
Sequence:CCGGCCTCATTCATTTAATCGAGATCTCGAGATCTCGATTAAATGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-1051s1c1
Sequence:CCGGCGCGTGTGTTATCAGTGACTTCTCGAGAAGTCACTGATAACACACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007561.1-1896s1c1
Sequence:CCGGCCACTATATCTGAGATGCCATCTCGAGATGGCATCTCAGATATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-864s1c1
Sequence:CCGGCCAATGGATCTCTGTGCAAATCTCGAGATTTGCACAGAGATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-451s21c1
Sequence:CCGGTAATCGAGATGAAACGATAATCTCGAGATTATCGTTTCATCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-842s21c1
Sequence:GTACCGGTTGCTTGTGATGGAGTATTATCTCGAGATAATACTCCATCACAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-970s21c1
Sequence:GTACCGGATTACCACGAGGAGATCATTACTCGAGTAATGATCTCCTCGTGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-1635s21c1
Sequence:CCGGTCGGGCCTTACCCAGATTATTCTCGAGAATAATCTGGGTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-3140s21c1
Sequence:CCGGTTCAAGCTTATGGAGTGAAATCTCGAGATTTCACTCCATAAGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007561
VALIDATED
BMPR2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-2381s1c1
Sequence:CCGGGCCAAGATGAATACAATCAATCTCGAGATTGATTGTATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-440s1c1
Sequence:CCGGCCTCATTCATTTAATCGAGATCTCGAGATCTCGATTAAATGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-1051s1c1
Sequence:CCGGCGCGTGTGTTATCAGTGACTTCTCGAGAAGTCACTGATAACACACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007561.1-1896s1c1
Sequence:CCGGCCACTATATCTGAGATGCCATCTCGAGATGGCATCTCAGATATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-864s1c1
Sequence:CCGGCCAATGGATCTCTGTGCAAATCTCGAGATTTGCACAGAGATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-451s21c1
Sequence:CCGGTAATCGAGATGAAACGATAATCTCGAGATTATCGTTTCATCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-842s21c1
Sequence:GTACCGGTTGCTTGTGATGGAGTATTATCTCGAGATAATACTCCATCACAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-970s21c1
Sequence:GTACCGGATTACCACGAGGAGATCATTACTCGAGTAATGATCTCCTCGTGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-1635s21c1
Sequence:CCGGTCGGGCCTTACCCAGATTATTCTCGAGAATAATCTGGGTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-3140s21c1
Sequence:CCGGTTCAAGCTTATGGAGTGAAATCTCGAGATTTCACTCCATAAGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007561
VALIDATED
BMPR2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-2381s1c1
Sequence:CCGGGCCAAGATGAATACAATCAATCTCGAGATTGATTGTATTCATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-440s1c1
Sequence:CCGGCCTCATTCATTTAATCGAGATCTCGAGATCTCGATTAAATGAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-1051s1c1
Sequence:CCGGCGCGTGTGTTATCAGTGACTTCTCGAGAAGTCACTGATAACACACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007561.1-1896s1c1
Sequence:CCGGCCACTATATCTGAGATGCCATCTCGAGATGGCATCTCAGATATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007561.1-864s1c1
Sequence:CCGGCCAATGGATCTCTGTGCAAATCTCGAGATTTGCACAGAGATCCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-451s21c1
Sequence:CCGGTAATCGAGATGAAACGATAATCTCGAGATTATCGTTTCATCTCGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-842s21c1
Sequence:GTACCGGTTGCTTGTGATGGAGTATTATCTCGAGATAATACTCCATCACAAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-970s21c1
Sequence:GTACCGGATTACCACGAGGAGATCATTACTCGAGTAATGATCTCCTCGTGGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-1635s21c1
Sequence:CCGGTCGGGCCTTACCCAGATTATTCTCGAGAATAATCTGGGTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007561.3-3140s21c1
Sequence:CCGGTTCAAGCTTATGGAGTGAAATCTCGAGATTTCACTCCATAAGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001204
VALIDATED
BMPR2 MISSION shRNA Bacterial Glycerol Stock
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.x-3537s1c1
Sequence:CCGGGCCTATGGAGTGAAATTATTTCTCGAGAAATAATTTCACTCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1180s1c1
Sequence:CCGGGCCCGCTTTATAGTTGGAGATCTCGAGATCTCCAACTATAAAGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-488s1c1
Sequence:CCGGCGCAGAATCAAGAACGGCTATCTCGAGATAGCCGTTCTTGATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1962s1c1
Sequence:CCGGCAATCCAATGTCTACTGCTATCTCGAGATAGCAGTAGACATTGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1313s1c1
Sequence:CCGGGCCGTCTTGCTCATTCTGTTACTCGAGTAACAGAATGAGCAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-618s1c1
Sequence:CCGGGAACGGCTATGTGCGTTTAAACTCGAGTTTAAACGCACATAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3600s1c1
Sequence:CCGGGCTACAACCATGGTGTCTAAACTCGAGTTTAGACACCATGGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-1113s1c1
Sequence:CCGGCCCTCTCTTGATCTAGATAATCTCGAGATTATCTAGATCAAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-3221s1c1
Sequence:CCGGCCGAACTAATTCCAATAACAACTCGAGTTGTTATTGGAATTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.5-6427s1c1
Sequence:CCGGCCTAACTGTATACCAGAATTACTCGAGTAATTCTGGTATACAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3055s1c1
Sequence:CCGGCCCAAGAAATGTTGCAGAATCCTCGAGGATTCTGCAACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001204.5-4303s1c1
Sequence:CCGGGCTACCTGATTTCTTACTTTCCTCGAGGAAAGTAAGAAATCAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001204
VALIDATED
BMPR2 MISSION shRNA shRNA Plasmid DNA
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.x-3537s1c1
Sequence:CCGGGCCTATGGAGTGAAATTATTTCTCGAGAAATAATTTCACTCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1180s1c1
Sequence:CCGGGCCCGCTTTATAGTTGGAGATCTCGAGATCTCCAACTATAAAGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-488s1c1
Sequence:CCGGCGCAGAATCAAGAACGGCTATCTCGAGATAGCCGTTCTTGATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1962s1c1
Sequence:CCGGCAATCCAATGTCTACTGCTATCTCGAGATAGCAGTAGACATTGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1313s1c1
Sequence:CCGGGCCGTCTTGCTCATTCTGTTACTCGAGTAACAGAATGAGCAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-618s1c1
Sequence:CCGGGAACGGCTATGTGCGTTTAAACTCGAGTTTAAACGCACATAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3600s1c1
Sequence:CCGGGCTACAACCATGGTGTCTAAACTCGAGTTTAGACACCATGGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-1113s1c1
Sequence:CCGGCCCTCTCTTGATCTAGATAATCTCGAGATTATCTAGATCAAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-3221s1c1
Sequence:CCGGCCGAACTAATTCCAATAACAACTCGAGTTGTTATTGGAATTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.5-6427s1c1
Sequence:CCGGCCTAACTGTATACCAGAATTACTCGAGTAATTCTGGTATACAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3055s1c1
Sequence:CCGGCCCAAGAAATGTTGCAGAATCCTCGAGGATTCTGCAACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001204.5-4303s1c1
Sequence:CCGGGCTACCTGATTTCTTACTTTCCTCGAGGAAAGTAAGAAATCAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001204
VALIDATED
BMPR2 MISSION shRNA Lentiviral Transduction Particles
bone morphogenetic protein receptor, type II (serine/threonine kinase)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000456    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.x-3537s1c1
Sequence:CCGGGCCTATGGAGTGAAATTATTTCTCGAGAAATAATTTCACTCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1180s1c1
Sequence:CCGGGCCCGCTTTATAGTTGGAGATCTCGAGATCTCCAACTATAAAGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-488s1c1
Sequence:CCGGCGCAGAATCAAGAACGGCTATCTCGAGATAGCCGTTCTTGATTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1962s1c1
Sequence:CCGGCAATCCAATGTCTACTGCTATCTCGAGATAGCAGTAGACATTGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.x-1313s1c1
Sequence:CCGGGCCGTCTTGCTCATTCTGTTACTCGAGTAACAGAATGAGCAAGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-618s1c1
Sequence:CCGGGAACGGCTATGTGCGTTTAAACTCGAGTTTAAACGCACATAGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3600s1c1
Sequence:CCGGGCTACAACCATGGTGTCTAAACTCGAGTTTAGACACCATGGTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-1113s1c1
Sequence:CCGGCCCTCTCTTGATCTAGATAATCTCGAGATTATCTAGATCAAGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001204.5-3221s1c1
Sequence:CCGGCCGAACTAATTCCAATAACAACTCGAGTTGTTATTGGAATTAGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001204.5-6427s1c1
Sequence:CCGGCCTAACTGTATACCAGAATTACTCGAGTAATTCTGGTATACAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001204.5-3055s1c1
Sequence:CCGGCCCAAGAAATGTTGCAGAATCCTCGAGGATTCTGCAACATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001204.5-4303s1c1
Sequence:CCGGGCTACCTGATTTCTTACTTTCCTCGAGGAAAGTAAGAAATCAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks