EMAIL THIS PAGE TO A FRIEND

BMS1

BMS1 ribosome biogenesis factor

58 Gene Product Result for
Synonyms: BMS1L
UniProtKB ID: Q14692, Q5QPT5, Q86XJ9
Gene ID:
Human(9790) Summary: This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Mouse(213895) BMS1 homolog, ribosome assembly protein (yeast)
Rat(362426) BMS1 homolog, ribosome assembly protein (yeast)
naked mole-rat(101716866) BMS1 ribosome biogenesis factor
domestic guinea pig(100734231) BMS1 ribosome biogenesis factor
sheep(101117987) BMS1 homolog, ribosome assembly protein (yeast)
chicken(423633) BMS1 homolog, ribosome assembly protein (yeast)
dog(477760) BMS1 homolog, ribosome assembly protein (yeast)
domestic cat(101101341) BMS1 homolog, ribosome assembly protein (yeast)
cow(514945) BMS1 homolog, ribosome assembly protein (yeast)
Horse(100056034) BMS1 homolog, ribosome assembly protein (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014753 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014753 Rosetta Predictions human pricing
XM_001057343 Rosetta Predictions rat pricing
XM_342746 Rosetta Predictions rat pricing
NM_194339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048331 predicted 2240
2 SASI_Hs01_00048332 predicted 2282
3 SASI_Hs01_00048333 predicted 1459
4 SASI_Hs02_00346220 predicted 3641
5 SASI_Hs01_00048334 predicted 1703
6 SASI_Hs01_00048335 predicted 1828
7 SASI_Hs02_00346221 predicted 3575
8 SASI_Hs01_00048337 predicted 2288
9 SASI_Hs01_00048338 predicted 1777
10 SASI_Hs01_00048339 predicted 1094
11 SASI_Hs01_00048330 predicted 532
12 SASI_Hs01_00048336 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286097 predicted 592
2 SASI_Rn02_00286098 predicted 2760
3 SASI_Rn02_00286099 predicted 415
4 SASI_Rn02_00286100 predicted 2405
5 SASI_Rn02_00286101 predicted 2716
6 SASI_Rn02_00286102 predicted 3937
7 SASI_Rn02_00286103 predicted 2959
8 SASI_Rn02_00286104 predicted 2900
9 SASI_Rn02_00286105 predicted 257
10 SASI_Rn02_00286106 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394731 predicted 2760
2 SASI_Rn02_00394732 predicted 1709
3 SASI_Rn02_00394733 predicted 2489
4 SASI_Rn02_00394734 predicted 2406
5 SASI_Rn02_00394735 predicted 2716
6 SASI_Rn02_00394736 predicted 3958
7 SASI_Rn02_00394737 predicted 2963
8 SASI_Rn02_00394738 predicted 2899
9 SASI_Rn02_00394739 predicted 2337
10 SASI_Rn02_00394740 predicted 2200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117237 predicted 2702
2 SASI_Mm01_00117238 predicted 2802
3 SASI_Mm01_00117239 predicted 2748
4 SASI_Mm02_00350618 predicted 2674
5 SASI_Mm01_00117241 predicted 2398
6 SASI_Mm01_00117242 predicted 489
7 SASI_Mm01_00117243 predicted 3935
8 SASI_Mm01_00117244 predicted 3440
9 SASI_Mm02_00350619 predicted 711
10 SASI_Mm01_00117245 predicted 399
11 SASI_Mm01_00117240 predicted 1376
12 SASI_Mm01_00117246 predicted 1533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194339
VALIDATED
BMS1 MISSION shRNA Bacterial Glycerol Stock
BMS1 ribosome biogenesis factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2647s21c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1682s21c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-3817s21c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1306s21c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2089s21c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1682s1c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194339.1-3817s1c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1306s1c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2647s1c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2089s1c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194339
VALIDATED
BMS1 MISSION shRNA shRNA Plasmid DNA
BMS1 ribosome biogenesis factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2647s21c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1682s21c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-3817s21c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1306s21c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2089s21c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1682s1c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194339.1-3817s1c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1306s1c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2647s1c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2089s1c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194339
VALIDATED
BMS1 MISSION shRNA Lentiviral Transduction Particles
BMS1 ribosome biogenesis factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2647s21c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1682s21c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-3817s21c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-1306s21c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194339.1-2089s21c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1682s1c1
Sequence:CCGGGCGTTTGCTGATAGCGATGATCTCGAGATCATCGCTATCAGCAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194339.1-3817s1c1
Sequence:CCGGGAGCACAATACACAGTCAGAACTCGAGTTCTGACTGTGTATTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-1306s1c1
Sequence:CCGGCCATGCCAGTATCGATGCTAACTCGAGTTAGCATCGATACTGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2647s1c1
Sequence:CCGGGCATCTGGATAAGAAGAGAAACTCGAGTTTCTCTTCTTATCCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194339.1-2089s1c1
Sequence:CCGGCGACATTGAAAGTTTACTCAACTCGAGTTGAGTAAACTTTCAATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014753
VALIDATED
BMS1 MISSION shRNA Bacterial Glycerol Stock
BMS1 ribosome biogenesis factor
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1551s21c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3386s21c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3657s21c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1655s21c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-4003s21c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014753.2-1028s1c1
Sequence:CCGGGCGCTGTTTAAATGAGAAGGACTCGAGTCCTTCTCATTTAAACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1655s1c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3386s1c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3657s1c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1551s1c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014753.2-3938s1c1
Sequence:CCGGGAGGTAGACAGTTTCAAACATCTCGAGATGTTTGAAACTGTCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-4003s1c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014753
VALIDATED
BMS1 MISSION shRNA shRNA Plasmid DNA
BMS1 ribosome biogenesis factor
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1551s21c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3386s21c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3657s21c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1655s21c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-4003s21c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014753.2-1028s1c1
Sequence:CCGGGCGCTGTTTAAATGAGAAGGACTCGAGTCCTTCTCATTTAAACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1655s1c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3386s1c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3657s1c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1551s1c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014753.2-3938s1c1
Sequence:CCGGGAGGTAGACAGTTTCAAACATCTCGAGATGTTTGAAACTGTCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-4003s1c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014753
VALIDATED
BMS1 MISSION shRNA Lentiviral Transduction Particles
BMS1 ribosome biogenesis factor
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1551s21c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3386s21c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-3657s21c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-1655s21c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014753.2-4003s21c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149290    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014753.2-1028s1c1
Sequence:CCGGGCGCTGTTTAAATGAGAAGGACTCGAGTCCTTCTCATTTAAACAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1655s1c1
Sequence:CCGGGAAGGGCATTTCAGGATCAAACTCGAGTTTGATCCTGAAATGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3386s1c1
Sequence:CCGGCCCAGTAACATCTTTGTTGAACTCGAGTTCAACAAAGATGTTACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-3657s1c1
Sequence:CCGGCCTCATGAAAGAAAGATCCTTCTCGAGAAGGATCTTTCTTTCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-1551s1c1
Sequence:CCGGGCATTTGCTGACAGTGACGATCTCGAGATCGTCACTGTCAGCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014753.2-3938s1c1
Sequence:CCGGGAGGTAGACAGTTTCAAACATCTCGAGATGTTTGAAACTGTCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014753.2-4003s1c1
Sequence:CCGGCAAGAGATGTCTCTACTCAAACTCGAGTTTGAGTAGAGACATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks