EMAIL THIS PAGE TO A FRIEND

BMS1P5

BMS1 pseudogene 5

88 Gene Product Result for
Synonyms: BMS1LP5
Species: Human BMS1P5(399761)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374801 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003611 Rosetta Predictions human pricing
XM_374801 Rosetta Predictions human pricing
XM_926792 Rosetta Predictions human pricing
XM_931540 Rosetta Predictions human pricing
XM_931547 Rosetta Predictions human pricing
XM_931551 Rosetta Predictions human pricing
XM_931555 Rosetta Predictions human pricing
XM_931561 Rosetta Predictions human pricing
XM_931570 Rosetta Predictions human pricing
XM_931575 Rosetta Predictions human pricing
XM_931586 Rosetta Predictions human pricing
XM_931597 Rosetta Predictions human pricing
XM_931603 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379885 predicted 2985
2 SASI_Hs02_00379886 predicted 2510
3 SASI_Hs02_00379887 predicted 2442
4 SASI_Hs02_00379888 predicted 3103
5 SASI_Hs02_00379889 predicted 3209
6 SASI_Hs02_00379890 predicted 2403
7 SASI_Hs02_00379891 predicted 2824
8 SASI_Hs02_00379892 predicted 2774
9 SASI_Hs02_00379893 predicted 2368
10 SASI_Hs02_00379894 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261578 predicted 1763
2 SASI_Hs01_00261579 predicted 1810
3 SASI_Hs01_00261580 predicted 1793
4 SASI_Hs01_00261581 predicted 1826
5 SASI_Hs01_00261582 predicted 1809
6 SASI_Hs01_00261583 predicted 1777
7 SASI_Hs01_00261584 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275404 predicted 2465
2 SASI_Hs01_00275405 predicted 2521
3 SASI_Hs01_00275406 predicted 2487
4 SASI_Hs01_00275407 predicted 2528
5 SASI_Hs01_00275408 predicted 2513
6 SASI_Hs01_00275409 predicted 2481
7 SASI_Hs01_00275410 predicted 2499
8 SASI_Hs01_00275411 predicted 2214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253372 predicted 1079
2 SASI_Hs01_00253373 predicted 539
3 SASI_Hs01_00253374 predicted 662
4 SASI_Hs01_00253375 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255406 predicted 2573
2 SASI_Hs01_00255407 predicted 2645
3 SASI_Hs01_00255408 predicted 2717
4 SASI_Hs01_00255409 predicted 2623
5 SASI_Hs01_00255410 predicted 2801
6 SASI_Hs01_00255411 predicted 2367
7 SASI_Hs01_00255412 predicted 2712
8 SASI_Hs01_00255413 predicted 2538
9 SASI_Hs01_00255414 predicted 2566
10 SASI_Hs01_00255415 predicted 2344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294139 predicted 2538
2 SASI_Hs01_00294140 predicted 2343
3 SASI_Hs01_00294141 predicted 2326
4 SASI_Hs01_00294142 predicted 2535
5 SASI_Hs01_00294143 predicted 2497
6 SASI_Hs01_00294144 predicted 2528
7 SASI_Hs01_00294145 predicted 2305
8 SASI_Hs01_00294146 predicted 2404
9 SASI_Hs01_00294147 predicted 2413
10 SASI_Hs01_00294148 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274827 predicted 2492
2 SASI_Hs01_00274828 predicted 2493
3 SASI_Hs01_00274829 predicted 2485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300494 predicted 2832
2 SASI_Hs01_00300495 predicted 2555
3 SASI_Hs01_00300496 predicted 2024
4 SASI_Hs01_00300497 predicted 2143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294540 predicted 2466
2 SASI_Hs01_00294541 predicted 2488
3 SASI_Hs01_00294542 predicted 2479
4 SASI_Hs01_00294543 predicted 2506
5 SASI_Hs01_00294544 predicted 2209
6 SASI_Hs01_00294545 predicted 2363
7 SASI_Hs01_00294546 predicted 2485
8 SASI_Hs01_00294547 predicted 2428
9 SASI_Hs01_00294548 predicted 2496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261702 predicted 705
2 SASI_Hs01_00261703 predicted 293
3 SASI_Hs01_00261704 predicted 977
4 SASI_Hs01_00261705 predicted 169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298211 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295710 predicted 2445
2 SASI_Hs01_00295711 predicted 2420
3 SASI_Hs01_00295712 predicted 2459
4 SASI_Hs01_00295713 predicted 2439
5 SASI_Hs01_00295714 predicted 2411
6 SASI_Hs01_00295715 predicted 2426
7 SASI_Hs01_00295716 predicted 2388
8 SASI_Hs01_00295717 predicted 2211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267131 predicted 2422
2 SASI_Hs01_00267132 predicted 2477
3 SASI_Hs01_00267133 predicted 2450
4 SASI_Hs01_00267134 predicted 2491
5 SASI_Hs01_00267135 predicted 2473
6 SASI_Hs01_00267136 predicted 2440
7 SASI_Hs01_00267137 predicted 2466
8 SASI_Hs01_00267138 predicted 2177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374801
BMS1P5 MISSION shRNA Bacterial Glycerol Stock
BMS1 pseudogene 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1794s1c1
Sequence:CCGGCCGTGTATCTACTGAGCGTTTCTCGAGAAACGCTCAGTAGATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2578s1c1
Sequence:CCGGCCCTCTCCTCATGCCAATAAACTCGAGTTTATTGGCATGAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2397s1c1
Sequence:CCGGCCTTCGGACATCTACCATCAACTCGAGTTGATGGTAGATGTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-3102s1c1
Sequence:CCGGCCATTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1904s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374801
BMS1P5 MISSION shRNA shRNA Plasmid DNA
BMS1 pseudogene 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1794s1c1
Sequence:CCGGCCGTGTATCTACTGAGCGTTTCTCGAGAAACGCTCAGTAGATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2578s1c1
Sequence:CCGGCCCTCTCCTCATGCCAATAAACTCGAGTTTATTGGCATGAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2397s1c1
Sequence:CCGGCCTTCGGACATCTACCATCAACTCGAGTTGATGGTAGATGTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-3102s1c1
Sequence:CCGGCCATTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1904s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374801
BMS1P5 MISSION shRNA Lentiviral Transduction Particles
BMS1 pseudogene 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1794s1c1
Sequence:CCGGCCGTGTATCTACTGAGCGTTTCTCGAGAAACGCTCAGTAGATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2578s1c1
Sequence:CCGGCCCTCTCCTCATGCCAATAAACTCGAGTTTATTGGCATGAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-2397s1c1
Sequence:CCGGCCTTCGGACATCTACCATCAACTCGAGTTGATGGTAGATGTCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-3102s1c1
Sequence:CCGGCCATTCCAAATATGAGGAGAACTCGAGTTCTCCTCATATTTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374801.1-1904s1c1
Sequence:CCGGCCTTGGAGATACCTCATCATACTCGAGTATGATGAGGTATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks