EMAIL THIS PAGE TO A FRIEND

BMX

BMX non-receptor tyrosine kinase

120 Gene Product Result for
Synonyms: ETK PSCTK2 PSCTK3
UniProtKB ID: P51813, A6NIH9, O60564, Q12871
Gene ID:
Human(660) Summary: This gene encodes a non-receptor tyrosine kinase belonging to the Tec kinase family. The protein contains a PH-like domain, which mediates membrane targeting by binding to phosphatidylinositol 3,4,5-triphosphate (PIP3), and a SH2 domain that binds to tyrosine-phosphorylated proteins and functions in signal transduction. The protein is implicated in several signal transduction pathways including the Stat pathway, and regulates differentiation and tumorigenicity of several types of cancer cells. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Sep 2009]
Mouse(12169) BMX non-receptor tyrosine kinase
Rat(367786) BMX non-receptor tyrosine kinase
chicken(428003) BMX non-receptor tyrosine kinase
cow(531514) BMX non-receptor tyrosine kinase
Horse(100051025) BMX non-receptor tyrosine kinase
dog(491750) BMX non-receptor tyrosine kinase
domestic cat(101095795) BMX non-receptor tyrosine kinase
sheep(101103124) BMX non-receptor tyrosine kinase
Domestic Rabbit(100350848) BMX non-receptor tyrosine kinase
domestic guinea pig(100733084) BMX non-receptor tyrosine kinase
naked mole-rat(101726373) BMX non-receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B1437 Anti-BMX (216-230) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
B1562 Anti-BMX (606-620) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA001048 Anti-BMX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502820 Anti-BMX, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502819 Anti-ETK, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502818 Anti-ETK, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504030 Anti-phospho-ETK (pTyr40) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504090 Anti-phospho-ETK (pTyr566) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301451 Anti-phospho-ETK (pTyr566) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
WH0000660M1 Monoclonal Anti-BMX antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300332 Monoclonal Anti-BMX antibody produced in mouse clone 1C6, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066711 MISSION® esiRNA esiRNA human BMX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001721 Rosetta Predictions human pricing
NM_203281 Rosetta Predictions human pricing
NM_001109016 Rosetta Predictions rat pricing
NM_009759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019552 predicted 1418
2 SASI_Hs01_00019553 predicted 729
3 SASI_Hs01_00019554 predicted 2204
4 SASI_Hs01_00019555 predicted 938
5 SASI_Hs02_00332421 predicted 979
6 SASI_Hs01_00019556 predicted 664
7 SASI_Hs01_00019557 predicted 1814
8 SASI_Hs01_00019558 predicted 1567
9 SASI_Hs01_00019559 predicted 1239
10 SASI_Hs01_00019560 predicted 1485
11 SASI_Hs01_00019561 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185298 predicted 1483
2 SASI_Hs01_00185299 predicted 795
3 SASI_Hs01_00185300 predicted 2266
4 SASI_Hs01_00185301 predicted 998
5 SASI_Hs02_00373182 predicted 1039
6 SASI_Hs01_00185302 predicted 726
7 SASI_Hs01_00185303 predicted 1883
8 SASI_Hs01_00185304 predicted 1629
9 SASI_Hs01_00185305 predicted 1306
10 SASI_Hs01_00185306 predicted 1554
11 SASI_Hs01_00185307 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244344 predicted 2186
2 SASI_Rn02_00244345 predicted 301
3 SASI_Rn02_00244346 predicted 1748
4 SASI_Rn02_00244347 predicted 1706
5 SASI_Rn02_00244348 predicted 2072
6 SASI_Rn02_00244349 predicted 1781
7 SASI_Rn02_00244350 predicted 859
8 SASI_Rn02_00244351 predicted 1531
9 SASI_Rn02_00244352 predicted 982
10 SASI_Rn02_00244353 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043928 predicted 1048
2 SASI_Mm02_00316948 predicted 1396
3 SASI_Mm01_00043929 predicted 1746
4 SASI_Mm02_00316949 predicted 1538
5 SASI_Mm01_00043930 predicted 2077
6 SASI_Mm01_00043931 predicted 269
7 SASI_Mm01_00043932 predicted 1119
8 SASI_Mm01_00043933 predicted 1497
9 SASI_Mm02_00316950 predicted 845
10 SASI_Mm01_00043934 predicted 2183
11 SASI_Mm01_00043935 predicted 2173
12 SASI_Mm01_00043936 predicted 516
13 SASI_Mm01_00043937 predicted 1686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001721
BMX MISSION shRNA Bacterial Glycerol Stock
BMX non-receptor tyrosine kinase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001721.3-2169s1c1
Sequence:CCGGGAGTGCTGATAAGAATGAATACTCGAGTATTCATTCTTATCAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-770s1c1
Sequence:CCGGGCAATATGACAGCAACTCAAACTCGAGTTTGAGTTGCTGTCATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-2122s1c1
Sequence:CCGGCCATTGAACCACTTCGGGAAACTCGAGTTTCCCGAAGTGGTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1961s1c1
Sequence:CCGGGCCCTATGACTTGTATGACAACTCGAGTTGTCATACAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1178s1c1
Sequence:CCGGCGTGCATACAAATGCTGAGAACTCGAGTTCTCAGCATTTGTATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1266s1c1
Sequence:CCGGCGCCACCCTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1551s1c1
Sequence:CCGGCCCATATACATAGTGACTGAACTCGAGTTCAGTCACTATGTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001721.4-2237s1c1
Sequence:CCGGGTGTTCTCTGTATTGTCTATTCTCGAGAATAGACAATACAGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1009s1c1
Sequence:CCGGGATCACAATCTGAACAGTTACCTCGAGGTAACTGTTCAGATTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001721
BMX MISSION shRNA shRNA Plasmid DNA
BMX non-receptor tyrosine kinase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001721.3-2169s1c1
Sequence:CCGGGAGTGCTGATAAGAATGAATACTCGAGTATTCATTCTTATCAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-770s1c1
Sequence:CCGGGCAATATGACAGCAACTCAAACTCGAGTTTGAGTTGCTGTCATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-2122s1c1
Sequence:CCGGCCATTGAACCACTTCGGGAAACTCGAGTTTCCCGAAGTGGTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1961s1c1
Sequence:CCGGGCCCTATGACTTGTATGACAACTCGAGTTGTCATACAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1178s1c1
Sequence:CCGGCGTGCATACAAATGCTGAGAACTCGAGTTCTCAGCATTTGTATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1266s1c1
Sequence:CCGGCGCCACCCTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1551s1c1
Sequence:CCGGCCCATATACATAGTGACTGAACTCGAGTTCAGTCACTATGTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001721.4-2237s1c1
Sequence:CCGGGTGTTCTCTGTATTGTCTATTCTCGAGAATAGACAATACAGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1009s1c1
Sequence:CCGGGATCACAATCTGAACAGTTACCTCGAGGTAACTGTTCAGATTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001721
BMX MISSION shRNA Lentiviral Transduction Particles
BMX non-receptor tyrosine kinase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006359    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001721.3-2169s1c1
Sequence:CCGGGAGTGCTGATAAGAATGAATACTCGAGTATTCATTCTTATCAGCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-770s1c1
Sequence:CCGGGCAATATGACAGCAACTCAAACTCGAGTTTGAGTTGCTGTCATATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-2122s1c1
Sequence:CCGGCCATTGAACCACTTCGGGAAACTCGAGTTTCCCGAAGTGGTTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1961s1c1
Sequence:CCGGGCCCTATGACTTGTATGACAACTCGAGTTGTCATACAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001721.3-1178s1c1
Sequence:CCGGCGTGCATACAAATGCTGAGAACTCGAGTTCTCAGCATTTGTATGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199362    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1266s1c1
Sequence:CCGGCGCCACCCTGTGTCAACAAAGCTCGAGCTTTGTTGACACAGGGTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1551s1c1
Sequence:CCGGCCCATATACATAGTGACTGAACTCGAGTTCAGTCACTATGTATATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196445    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001721.4-2237s1c1
Sequence:CCGGGTGTTCTCTGTATTGTCTATTCTCGAGAATAGACAATACAGAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001721.4-1009s1c1
Sequence:CCGGGATCACAATCTGAACAGTTACCTCGAGGTAACTGTTCAGATTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009759
BMX MISSION shRNA Bacterial Glycerol Stock
BMX non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1917s1c1
Sequence:CCGGGCCCTATGACTTATATGATAACTCGAGTTATCATATAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1215s1c1
Sequence:CCGGCCAACATAATTCAGCAGGCATCTCGAGATGCCTGCTGAATTATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-772s1c1
Sequence:CCGGCCAACCAGCAACATACGCTATCTCGAGATAGCGTATGTTGCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1512s1c1
Sequence:CCGGCGGAGTATGCTCAAAGAAATACTCGAGTATTTCTTTGAGCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-496s1c1
Sequence:CCGGCCTCACCTGTTGATCAAGTATCTCGAGATACTTGATCAACAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1743s21c1
Sequence:CCGGGACTTTGGAATGACGAGATATCTCGAGATATCTCGTCATTCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-774s21c1
Sequence:CCGGACCAGCAACATACGCTATATTCTCGAGAATATAGCGTATGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1069s21c1
Sequence:CCGGTGTACACTGTGTCCTTATTTACTCGAGTAAATAAGGACACAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009759
BMX MISSION shRNA shRNA Plasmid DNA
BMX non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1917s1c1
Sequence:CCGGGCCCTATGACTTATATGATAACTCGAGTTATCATATAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1215s1c1
Sequence:CCGGCCAACATAATTCAGCAGGCATCTCGAGATGCCTGCTGAATTATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-772s1c1
Sequence:CCGGCCAACCAGCAACATACGCTATCTCGAGATAGCGTATGTTGCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1512s1c1
Sequence:CCGGCGGAGTATGCTCAAAGAAATACTCGAGTATTTCTTTGAGCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-496s1c1
Sequence:CCGGCCTCACCTGTTGATCAAGTATCTCGAGATACTTGATCAACAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1743s21c1
Sequence:CCGGGACTTTGGAATGACGAGATATCTCGAGATATCTCGTCATTCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-774s21c1
Sequence:CCGGACCAGCAACATACGCTATATTCTCGAGAATATAGCGTATGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1069s21c1
Sequence:CCGGTGTACACTGTGTCCTTATTTACTCGAGTAAATAAGGACACAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009759
BMX MISSION shRNA Lentiviral Transduction Particles
BMX non-receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1917s1c1
Sequence:CCGGGCCCTATGACTTATATGATAACTCGAGTTATCATATAAGTCATAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1215s1c1
Sequence:CCGGCCAACATAATTCAGCAGGCATCTCGAGATGCCTGCTGAATTATGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-772s1c1
Sequence:CCGGCCAACCAGCAACATACGCTATCTCGAGATAGCGTATGTTGCTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-1512s1c1
Sequence:CCGGCGGAGTATGCTCAAAGAAATACTCGAGTATTTCTTTGAGCATACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009759.2-496s1c1
Sequence:CCGGCCTCACCTGTTGATCAAGTATCTCGAGATACTTGATCAACAGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1743s21c1
Sequence:CCGGGACTTTGGAATGACGAGATATCTCGAGATATCTCGTCATTCCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-774s21c1
Sequence:CCGGACCAGCAACATACGCTATATTCTCGAGAATATAGCGTATGTTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009759.4-1069s21c1
Sequence:CCGGTGTACACTGTGTCCTTATTTACTCGAGTAAATAAGGACACAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks