EMAIL THIS PAGE TO A FRIEND

BNC1

basonuclin 1

145 Gene Product Result for
Synonyms: BNC BSN1 HsT19447
UniProtKB ID: Q01954, Q15840
Gene ID:
Human(646) Summary: The protein encoded by this gene is a zinc finger protein present in the basal cell layer of the epidermis and in hair follicles. It is also found in abundance in the germ cells of testis and ovary. This protein is thought to play a regulatory role in keratinocyte proliferation and it may also be a regulator for rRNA transcription. This gene seems to have multiple alternatively spliced transcript variants, but their full-length nature is not known yet. There seems to be evidence of multiple polyadenylation sites for this gene. [provided by RefSeq, Jul 2008]
Mouse(12173) basonuclin 1
Rat(365299) basonuclin 1
Zebrafish(325002) basonuclin 1
cow(524182) basonuclin 1
dog(488756) basonuclin 1
chicken(427504) basonuclin 1
sheep(101107140) basonuclin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007562 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007562 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007562 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001717 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001717 Rosetta Predictions human pricing
NM_001108916 Rosetta Predictions rat pricing
NM_007562 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021120 predicted 2526
2 SASI_Hs01_00021121 predicted 1173
3 SASI_Hs02_00332415 predicted 1063
4 SASI_Hs01_00021122 predicted 2419
5 SASI_Hs01_00021123 predicted 608
6 SASI_Hs01_00021124 predicted 2456
7 SASI_Hs01_00021125 predicted 2762
8 SASI_Hs02_00332416 predicted 2583
9 SASI_Hs01_00021126 predicted 3088
10 SASI_Hs01_00021127 predicted 2891
11 SASI_Hs01_00021128 predicted 1082
12 SASI_Hs01_00021129 predicted 2302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243354 predicted 420
2 SASI_Rn02_00243355 predicted 2982
3 SASI_Rn02_00243356 predicted 1145
4 SASI_Rn02_00243357 predicted 1999
5 SASI_Rn02_00243358 predicted 1301
6 SASI_Rn02_00243359 predicted 2403
7 SASI_Rn02_00243360 predicted 244
8 SASI_Rn02_00243361 predicted 2190
9 SASI_Rn02_00243362 predicted 1609
10 SASI_Rn02_00243363 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007562 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141190 predicted 353
2 SASI_Mm01_00141193 predicted 417
3 SASI_Mm01_00141194 predicted 262
4 SASI_Mm01_00141195 predicted 1131
5 SASI_Mm01_00141196 predicted 2342
6 SASI_Mm01_00141197 predicted 1304
7 SASI_Mm01_00141199 predicted 2407
8 SASI_Mm01_00141198 predicted 2649
9 SASI_Mm02_00311928 predicted 2805
10 SASI_Mm02_00311929 predicted 954
11 SASI_Mm01_00141191 predicted 2366
12 SASI_Mm01_00141192 predicted 2626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007562
VALIDATED
BNC1 MISSION shRNA Bacterial Glycerol Stock
basonuclin 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-3972s1c1
Sequence:CCGGGCCTTGTTCTATGTCTTAATACTCGAGTATTAAGACATAGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-1114s1c1
Sequence:CCGGCGAAGGGTGTAACATGGTGTTCTCGAGAACACCATGTTACACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-82s1c1
Sequence:CCGGCCAATGTTTCAAACCTGGGAACTCGAGTTCCCAGGTTTGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-2427s1c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-371s1c1
Sequence:CCGGCGTGGATATGTGTTACAGGATCTCGAGATCCTGTAACACATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-959s21c1
Sequence:CCGGTAAGCGACTCCAGCTCATATACTCGAGTATATGAGCTGGAGTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-2480s21c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007562.2-3155s21c1
Sequence:CCGGGGGTAGCCCTTCCTATTATTTCTCGAGAAATAATAGGAAGGGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-1126s21c1
Sequence:CCGGTACAACGCCGTCCACCTAAAGCTCGAGCTTTAGGTGGACGGCGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-413s21c1
Sequence:CCGGAGGATTACATCCGTGGATATGCTCGAGCATATCCACGGATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-2998s21c1
Sequence:CCGGTATAAGTGTTTGCCATATTTCCTCGAGGAAATATGGCAAACACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007562
VALIDATED
BNC1 MISSION shRNA shRNA Plasmid DNA
basonuclin 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-3972s1c1
Sequence:CCGGGCCTTGTTCTATGTCTTAATACTCGAGTATTAAGACATAGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-1114s1c1
Sequence:CCGGCGAAGGGTGTAACATGGTGTTCTCGAGAACACCATGTTACACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-82s1c1
Sequence:CCGGCCAATGTTTCAAACCTGGGAACTCGAGTTCCCAGGTTTGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-2427s1c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-371s1c1
Sequence:CCGGCGTGGATATGTGTTACAGGATCTCGAGATCCTGTAACACATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-959s21c1
Sequence:CCGGTAAGCGACTCCAGCTCATATACTCGAGTATATGAGCTGGAGTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-2480s21c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007562.2-3155s21c1
Sequence:CCGGGGGTAGCCCTTCCTATTATTTCTCGAGAAATAATAGGAAGGGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-1126s21c1
Sequence:CCGGTACAACGCCGTCCACCTAAAGCTCGAGCTTTAGGTGGACGGCGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-413s21c1
Sequence:CCGGAGGATTACATCCGTGGATATGCTCGAGCATATCCACGGATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-2998s21c1
Sequence:CCGGTATAAGTGTTTGCCATATTTCCTCGAGGAAATATGGCAAACACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007562
VALIDATED
BNC1 MISSION shRNA Lentiviral Transduction Particles
basonuclin 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-3972s1c1
Sequence:CCGGGCCTTGTTCTATGTCTTAATACTCGAGTATTAAGACATAGAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-1114s1c1
Sequence:CCGGCGAAGGGTGTAACATGGTGTTCTCGAGAACACCATGTTACACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-82s1c1
Sequence:CCGGCCAATGTTTCAAACCTGGGAACTCGAGTTCCCAGGTTTGAAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007562.1-2427s1c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007562.1-371s1c1
Sequence:CCGGCGTGGATATGTGTTACAGGATCTCGAGATCCTGTAACACATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-959s21c1
Sequence:CCGGTAAGCGACTCCAGCTCATATACTCGAGTATATGAGCTGGAGTCGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-2480s21c1
Sequence:CCGGGCAGTCTGGTTTACCCAATATCTCGAGATATTGGGTAAACCAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007562.2-3155s21c1
Sequence:CCGGGGGTAGCCCTTCCTATTATTTCTCGAGAAATAATAGGAAGGGCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-1126s21c1
Sequence:CCGGTACAACGCCGTCCACCTAAAGCTCGAGCTTTAGGTGGACGGCGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007562.2-413s21c1
Sequence:CCGGAGGATTACATCCGTGGATATGCTCGAGCATATCCACGGATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374541    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007562.2-2998s21c1
Sequence:CCGGTATAAGTGTTTGCCATATTTCCTCGAGGAAATATGGCAAACACTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001717
BNC1 MISSION shRNA Bacterial Glycerol Stock
basonuclin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-969s1c1
Sequence:CCGGCCACACCATTTCAGGTTGAAACTCGAGTTTCAACCTGAAATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-793s1c1
Sequence:CCGGCCTCATAAGCAACATGACTTTCTCGAGAAAGTCATGTTGCTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-2171s1c1
Sequence:CCGGCCTTGTCTTGAAGATTCTAAACTCGAGTTTAGAATCTTCAAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-848s21c1
Sequence:CCGGCCTGCACTGATAGGGTCATTGCTCGAGCAATGACCCTATCAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-2440s21c1
Sequence:CCGGGGAGAGTAGTGAAGATCATTTCTCGAGAAATGATCTTCACTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001717
BNC1 MISSION shRNA shRNA Plasmid DNA
basonuclin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-969s1c1
Sequence:CCGGCCACACCATTTCAGGTTGAAACTCGAGTTTCAACCTGAAATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-793s1c1
Sequence:CCGGCCTCATAAGCAACATGACTTTCTCGAGAAAGTCATGTTGCTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-2171s1c1
Sequence:CCGGCCTTGTCTTGAAGATTCTAAACTCGAGTTTAGAATCTTCAAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-848s21c1
Sequence:CCGGCCTGCACTGATAGGGTCATTGCTCGAGCAATGACCCTATCAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-2440s21c1
Sequence:CCGGGGAGAGTAGTGAAGATCATTTCTCGAGAAATGATCTTCACTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001717
BNC1 MISSION shRNA Lentiviral Transduction Particles
basonuclin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-969s1c1
Sequence:CCGGCCACACCATTTCAGGTTGAAACTCGAGTTTCAACCTGAAATGGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-793s1c1
Sequence:CCGGCCTCATAAGCAACATGACTTTCTCGAGAAAGTCATGTTGCTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001717.2-2171s1c1
Sequence:CCGGCCTTGTCTTGAAGATTCTAAACTCGAGTTTAGAATCTTCAAGACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-848s21c1
Sequence:CCGGCCTGCACTGATAGGGTCATTGCTCGAGCAATGACCCTATCAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001717.3-2440s21c1
Sequence:CCGGGGAGAGTAGTGAAGATCATTTCTCGAGAAATGATCTTCACTACTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks