EMAIL THIS PAGE TO A FRIEND

BNC2

basonuclin 2

363 Gene Product Result for
Synonyms: BSN2
UniProtKB ID: Q6ZN30, B1APG9, Q6T3A3, Q8NAR2, Q9H6J0, Q9NXV0
Gene ID:
Mouse(242509) basonuclin 2
Rat(298189) basonuclin 2
sheep(101122574) basonuclin 2
Zebrafish(559327) basonuclin 2
chicken(431604) basonuclin 2
cow(540746) basonuclin 2
Horse(100062869) basonuclin 2
dog(612979) basonuclin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018525 Anti-BNC2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106468 Anti-BNC2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, human, horse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017637 Rosetta Predictions human pricing
NM_001106666 Rosetta Predictions rat pricing
NM_172870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037379 predicted 1239
2 SASI_Hs01_00037380 predicted 1265
3 SASI_Hs01_00037381 predicted 3200
4 SASI_Hs01_00037382 predicted 2785
5 SASI_Hs01_00037383 predicted 1481
6 SASI_Hs01_00037384 predicted 1284
7 SASI_Hs01_00037385 predicted 1765
8 SASI_Hs01_00037386 predicted 1819
9 SASI_Hs01_00037387 predicted 975
10 SASI_Hs01_00037388 predicted 2176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221188 predicted 1515
2 SASI_Rn02_00221189 predicted 3334
3 SASI_Rn02_00221190 predicted 1247
4 SASI_Rn02_00221191 predicted 1917
5 SASI_Rn02_00221192 predicted 2252
6 SASI_Rn02_00221193 predicted 916
7 SASI_Rn02_00221194 predicted 1321
8 SASI_Rn02_00221195 predicted 565
9 SASI_Rn02_00221196 predicted 3254
10 SASI_Rn02_00221197 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155507 predicted 3049
2 SASI_Mm01_00155508 predicted 1315
3 SASI_Mm01_00155509 predicted 2224
4 SASI_Mm01_00155510 predicted 1010
5 SASI_Mm02_00344841 predicted 719
6 SASI_Mm01_00155511 predicted 1741
7 SASI_Mm01_00155512 predicted 1838
8 SASI_Mm01_00155513 predicted 1777
9 SASI_Mm01_00155514 predicted 953
10 SASI_Mm01_00155515 predicted 1047
11 SASI_Mm01_00155516 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017637
VALIDATED
BNC2 MISSION shRNA Bacterial Glycerol Stock
basonuclin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1800s21c1
Sequence:CCGGCTCCCTAGCCAGCTAGTATTTCTCGAGAAATACTAGCTGGCTAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-210s21c1
Sequence:CCGGCAAGACTGGCCAGCATATTTCCTCGAGGAAATATGCTGGCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-2805s21c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1203s21c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017637.5-3499s21c1
Sequence:CCGGCCATAGTCAGTGTGCGCTTATCTCGAGATAAGCGCACACTGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017637.4-4282s1c1
Sequence:CCGGGCCGAATGTTATTAGAATCAACTCGAGTTGATTCTAATAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017637.4-165s1c1
Sequence:CCGGCGCTGATACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-2536s1c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-934s1c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-1428s1c1
Sequence:CCGGCCCTGTCATAGCAAGTACAAACTCGAGTTTGTACTTGCTATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017637
VALIDATED
BNC2 MISSION shRNA shRNA Plasmid DNA
basonuclin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1800s21c1
Sequence:CCGGCTCCCTAGCCAGCTAGTATTTCTCGAGAAATACTAGCTGGCTAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-210s21c1
Sequence:CCGGCAAGACTGGCCAGCATATTTCCTCGAGGAAATATGCTGGCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-2805s21c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1203s21c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017637.5-3499s21c1
Sequence:CCGGCCATAGTCAGTGTGCGCTTATCTCGAGATAAGCGCACACTGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017637.4-4282s1c1
Sequence:CCGGGCCGAATGTTATTAGAATCAACTCGAGTTGATTCTAATAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017637.4-165s1c1
Sequence:CCGGCGCTGATACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-2536s1c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-934s1c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-1428s1c1
Sequence:CCGGCCCTGTCATAGCAAGTACAAACTCGAGTTTGTACTTGCTATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017637
VALIDATED
BNC2 MISSION shRNA Lentiviral Transduction Particles
basonuclin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1800s21c1
Sequence:CCGGCTCCCTAGCCAGCTAGTATTTCTCGAGAAATACTAGCTGGCTAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-210s21c1
Sequence:CCGGCAAGACTGGCCAGCATATTTCCTCGAGGAAATATGCTGGCCAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-2805s21c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017637.5-1203s21c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017637.5-3499s21c1
Sequence:CCGGCCATAGTCAGTGTGCGCTTATCTCGAGATAAGCGCACACTGACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017637.4-4282s1c1
Sequence:CCGGGCCGAATGTTATTAGAATCAACTCGAGTTGATTCTAATAACATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017637.4-165s1c1
Sequence:CCGGCGCTGATACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-2536s1c1
Sequence:CCGGCGTAAACTGTTGACCAAAGAACTCGAGTTCTTTGGTCAACAGTTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-934s1c1
Sequence:CCGGCCCAGCCTTTCAACTCAGAATCTCGAGATTCTGAGTTGAAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_017637.4-1428s1c1
Sequence:CCGGCCCTGTCATAGCAAGTACAAACTCGAGTTTGTACTTGCTATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172870
BNC2 MISSION shRNA Bacterial Glycerol Stock
basonuclin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172870.3-3693s1c1
Sequence:CCGGGCATGGCAGATTCACCTGTAACTCGAGTTACAGGTGAATCTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-93s1c1
Sequence:CCGGCGCTGACACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1387s1c1
Sequence:CCGGCTAAGGAATAACCGAGACAAACTCGAGTTTGTCTCGGTTATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1386s1c1
Sequence:CCGGGCTAAGGAATAACCGAGACAACTCGAGTTGTCTCGGTTATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-946s1c1
Sequence:CCGGCCGAGCATTTCAACTCAGAATCTCGAGATTCTGAGTTGAAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172870
BNC2 MISSION shRNA shRNA Plasmid DNA
basonuclin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172870.3-3693s1c1
Sequence:CCGGGCATGGCAGATTCACCTGTAACTCGAGTTACAGGTGAATCTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-93s1c1
Sequence:CCGGCGCTGACACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1387s1c1
Sequence:CCGGCTAAGGAATAACCGAGACAAACTCGAGTTTGTCTCGGTTATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1386s1c1
Sequence:CCGGGCTAAGGAATAACCGAGACAACTCGAGTTGTCTCGGTTATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-946s1c1
Sequence:CCGGCCGAGCATTTCAACTCAGAATCTCGAGATTCTGAGTTGAAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172870
BNC2 MISSION shRNA Lentiviral Transduction Particles
basonuclin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172870.3-3693s1c1
Sequence:CCGGGCATGGCAGATTCACCTGTAACTCGAGTTACAGGTGAATCTGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-93s1c1
Sequence:CCGGCGCTGACACTAACCTCTTATTCTCGAGAATAAGAGGTTAGTGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1387s1c1
Sequence:CCGGCTAAGGAATAACCGAGACAAACTCGAGTTTGTCTCGGTTATTCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-1386s1c1
Sequence:CCGGGCTAAGGAATAACCGAGACAACTCGAGTTGTCTCGGTTATTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172870.3-946s1c1
Sequence:CCGGCCGAGCATTTCAACTCAGAATCTCGAGATTCTGAGTTGAAATGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks