EMAIL THIS PAGE TO A FRIEND

BNIP1

BCL2/adenovirus E1B 19kDa interacting protein 1

109 Gene Product Result for
Synonyms: NIP1 SEC20 TRG-8
Gene ID:
Human(662) Summary: This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]
Mouse(224630) BCL2/adenovirus E1B interacting protein 1
Rat(140932) BCL2/adenovirus E1B interacting protein 1
chicken(416207) BCL2/adenovirus E1B 19kDa interacting protein 1
domestic cat(101090989) BCL2/adenovirus E1B 19kDa interacting protein 1
cow(614520) BCL2/adenovirus E1B 19kDa interacting protein 1
dog(609594) BCL2/adenovirus E1B 19kDa interacting protein 1
domestic guinea pig(100726766) BCL2/adenovirus E1B 19kDa interacting protein 1
naked mole-rat(101724941) BCL2/adenovirus E1B 19kDa interacting protein 1
sheep(101108952) BCL2/adenovirus E1B 19kDa interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172149 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172149 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172149 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001205 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001205 Rosetta Predictions human pricing
NM_013978 Rosetta Predictions human pricing
NM_013979 Rosetta Predictions human pricing
NM_013980 Rosetta Predictions human pricing
NM_080897 Rosetta Predictions rat pricing
NM_172149 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331344 predicted 726
2 SASI_Hs02_00331345 predicted 857
3 SASI_Hs01_00219161 predicted 695
4 SASI_Hs02_00331346 predicted 857
5 SASI_Hs02_00331347 predicted 1024
6 SASI_Hs02_00331348 predicted 846
7 SASI_Hs02_00331349 predicted 690
8 SASI_Hs02_00331350 predicted 724
9 SASI_Hs01_00219166 predicted 950
10 SASI_Hs02_00331351 predicted 980
11 SASI_Hs01_00219158 predicted 507
12 SASI_Hs01_00219159 predicted 488
13 SASI_Hs01_00219160 predicted 508
14 SASI_Hs01_00219162 predicted 416
15 SASI_Hs01_00219163 predicted 719
16 SASI_Hs01_00219164 predicted 502
17 SASI_Hs01_00219165 predicted 495
18 SASI_Hs01_00219167 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344925 predicted 630
2 SASI_Hs02_00344926 predicted 754
3 SASI_Hs01_00237318 predicted 593
4 SASI_Hs02_00344927 predicted 753
5 SASI_Hs02_00344928 predicted 922
6 SASI_Hs02_00344929 predicted 751
7 SASI_Hs02_00344930 predicted 590
8 SASI_Hs02_00344931 predicted 625
9 SASI_Hs02_00344932 predicted 847
10 SASI_Hs02_00344933 predicted 872
11 SASI_Hs01_00237316 predicted 401
12 SASI_Hs01_00237317 predicted 405
13 SASI_Hs01_00237319 predicted 294
14 SASI_Hs01_00237320 predicted 393
15 SASI_Hs01_00237321 predicted 376
16 SASI_Hs01_00237322 predicted 384
17 SASI_Hs01_00237323 predicted 373
18 SASI_Hs01_00237324 predicted 451
19 SASI_Hs01_00237325 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167756 predicted 853
2 SASI_Hs01_00167757 predicted 981
3 SASI_Hs01_00167758 predicted 823
4 SASI_Hs01_00167759 predicted 988
5 SASI_Hs02_00344934 predicted 1156
6 SASI_Hs01_00167761 predicted 980
7 SASI_Hs01_00167762 predicted 822
8 SASI_Hs02_00344935 predicted 858
9 SASI_Hs01_00167764 predicted 1077
10 SASI_Hs02_00344936 predicted 1109
11 SASI_Hs01_00167760 predicted 854
12 SASI_Hs01_00167763 predicted 846
13 SASI_Hs01_00167765 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190008 predicted 759
2 SASI_Hs01_00190009 predicted 884
3 SASI_Hs01_00190010 predicted 728
4 SASI_Hs01_00190011 predicted 889
5 SASI_Hs02_00344937 predicted 1053
6 SASI_Hs01_00190013 predicted 878
7 SASI_Hs01_00190014 predicted 722
8 SASI_Hs02_00344938 predicted 758
9 SASI_Hs01_00190016 predicted 972
10 SASI_Hs01_00190017 predicted 1005
11 SASI_Hs01_00190012 predicted 745
12 SASI_Hs01_00190015 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056864 predicted 847
2 SASI_Rn01_00056865 predicted 600
3 SASI_Rn01_00056866 predicted 599
4 SASI_Rn01_00056868 predicted 360
5 SASI_Rn01_00056869 predicted 506
6 SASI_Rn01_00056870 predicted 489
7 SASI_Rn01_00056871 predicted 553
8 SASI_Rn01_00056872 predicted 478
9 SASI_Rn02_00267350 predicted 327
10 SASI_Rn01_00056873 predicted 312
11 SASI_Rn01_00056867 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172149 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162607 predicted 749
2 SASI_Mm01_00162608 predicted 562
3 SASI_Mm01_00162609 predicted 640
4 SASI_Mm01_00162610 predicted 499
5 SASI_Mm01_00162612 predicted 269
6 SASI_Mm01_00162613 predicted 331
7 SASI_Mm01_00162614 predicted 347
8 SASI_Mm01_00162615 predicted 440
9 SASI_Mm01_00162616 predicted 794
10 SASI_Mm02_00343697 predicted 482
11 SASI_Mm01_00162611 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172149
VALIDATED
BNIP1 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 1
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-225s1c1
Sequence:CCGGGCTTCTACTTCAGGAAGTGGACTCGAGTCCACTTCCTGAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-43s1c1
Sequence:CCGGGAGATTGTCAAATTCGACCTACTCGAGTAGGTCGAATTTGACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-28s1c1
Sequence:CCGGCGGATCTGTAACCAAGAGATTCTCGAGAATCTCTTGGTTACAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-201s1c1
Sequence:CCGGGCAAGACAAGGAGTCAGAGAACTCGAGTTCTCTGACTCCTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-292s1c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-127s1c1
Sequence:CCGGCTGAATACTAAGGTGAAAGAACTCGAGTTCTTTCACCTTAGTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-117s1c1
Sequence:CCGGGCTTACTGAACTGAATACTAACTCGAGTTAGTATTCAGTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-328s1c1
Sequence:CCGGGAGAAGGCAGAACTTCTGCAACTCGAGTTGCAGAAGTTCTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-355s1c1
Sequence:CCGGGACTCCTTACGGCAAAGGAAACTCGAGTTTCCTTTGCCGTAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-860s21c1
Sequence:CCGGTTGGCAAGGGTGTGTGGAATACTCGAGTATTCCACACACCCTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-50s21c1
Sequence:CCGGTAACCAAGAGATTGTCAAATTCTCGAGAATTTGACAATCTCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-74s21c1
Sequence:CCGGCCTAGAGGTGAAGGCGCTTATCTCGAGATAAGCGCCTTCACCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-63s21c1
Sequence:CCGGCTAGAGGTGAAGGCGCTTATCCTCGAGGATAAGCGCCTTCACCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-37s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172149.4-638s21c1
Sequence:CCGGCCTCGCTACAGTCCTTTATATCTCGAGATATAAAGGACTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-849s21c1
Sequence:CCGGTGGCAAGGGTGTGTGGAATAGCTCGAGCTATTCCACACACCCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-294s21c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172149
VALIDATED
BNIP1 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 1
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-225s1c1
Sequence:CCGGGCTTCTACTTCAGGAAGTGGACTCGAGTCCACTTCCTGAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-43s1c1
Sequence:CCGGGAGATTGTCAAATTCGACCTACTCGAGTAGGTCGAATTTGACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-28s1c1
Sequence:CCGGCGGATCTGTAACCAAGAGATTCTCGAGAATCTCTTGGTTACAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-201s1c1
Sequence:CCGGGCAAGACAAGGAGTCAGAGAACTCGAGTTCTCTGACTCCTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-292s1c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-127s1c1
Sequence:CCGGCTGAATACTAAGGTGAAAGAACTCGAGTTCTTTCACCTTAGTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-117s1c1
Sequence:CCGGGCTTACTGAACTGAATACTAACTCGAGTTAGTATTCAGTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-328s1c1
Sequence:CCGGGAGAAGGCAGAACTTCTGCAACTCGAGTTGCAGAAGTTCTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-355s1c1
Sequence:CCGGGACTCCTTACGGCAAAGGAAACTCGAGTTTCCTTTGCCGTAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-860s21c1
Sequence:CCGGTTGGCAAGGGTGTGTGGAATACTCGAGTATTCCACACACCCTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-50s21c1
Sequence:CCGGTAACCAAGAGATTGTCAAATTCTCGAGAATTTGACAATCTCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-74s21c1
Sequence:CCGGCCTAGAGGTGAAGGCGCTTATCTCGAGATAAGCGCCTTCACCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-63s21c1
Sequence:CCGGCTAGAGGTGAAGGCGCTTATCCTCGAGGATAAGCGCCTTCACCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-37s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172149.4-638s21c1
Sequence:CCGGCCTCGCTACAGTCCTTTATATCTCGAGATATAAAGGACTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-849s21c1
Sequence:CCGGTGGCAAGGGTGTGTGGAATAGCTCGAGCTATTCCACACACCCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-294s21c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172149
VALIDATED
BNIP1 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 1
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-225s1c1
Sequence:CCGGGCTTCTACTTCAGGAAGTGGACTCGAGTCCACTTCCTGAAGTAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-43s1c1
Sequence:CCGGGAGATTGTCAAATTCGACCTACTCGAGTAGGTCGAATTTGACAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198081    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-28s1c1
Sequence:CCGGCGGATCTGTAACCAAGAGATTCTCGAGAATCTCTTGGTTACAGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-201s1c1
Sequence:CCGGGCAAGACAAGGAGTCAGAGAACTCGAGTTCTCTGACTCCTTGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-292s1c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-127s1c1
Sequence:CCGGCTGAATACTAAGGTGAAAGAACTCGAGTTCTTTCACCTTAGTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-117s1c1
Sequence:CCGGGCTTACTGAACTGAATACTAACTCGAGTTAGTATTCAGTTCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172149.2-328s1c1
Sequence:CCGGGAGAAGGCAGAACTTCTGCAACTCGAGTTGCAGAAGTTCTGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172149.2-355s1c1
Sequence:CCGGGACTCCTTACGGCAAAGGAAACTCGAGTTTCCTTTGCCGTAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-860s21c1
Sequence:CCGGTTGGCAAGGGTGTGTGGAATACTCGAGTATTCCACACACCCTTGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-50s21c1
Sequence:CCGGTAACCAAGAGATTGTCAAATTCTCGAGAATTTGACAATCTCTTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.5-74s21c1
Sequence:CCGGCCTAGAGGTGAAGGCGCTTATCTCGAGATAAGCGCCTTCACCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-63s21c1
Sequence:CCGGCTAGAGGTGAAGGCGCTTATCCTCGAGGATAAGCGCCTTCACCTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-37s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172149.4-638s21c1
Sequence:CCGGCCTCGCTACAGTCCTTTATATCTCGAGATATAAAGGACTGTAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-849s21c1
Sequence:CCGGTGGCAAGGGTGTGTGGAATAGCTCGAGCTATTCCACACACCCTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172149.4-294s21c1
Sequence:CCGGGCCAATCTTACCTGCAAGCTTCTCGAGAAGCTTGCAGGTAAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001205
VALIDATED
BNIP1 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-37s1c1
Sequence:CCGGCCGGATCTGTAACCAAGAGATCTCGAGATCTCTTGGTTACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001205.1-617s1c1
Sequence:CCGGCTTCTCATCTTCCTTGCGCTACTCGAGTAGCGCAAGGAAGATGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-323s1c1
Sequence:CCGGGCAATCGACAATCTAGAGAAACTCGAGTTTCTCTAGATTGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-101s1c1
Sequence:CCGGCGTGATTGTTCAGGACCCTTACTCGAGTAAGGGTCCTGAACAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-512s1c1
Sequence:CCGGCGAACGATCCTGGATGCAAATCTCGAGATTTGCATCCAGGATCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-418s21c1
Sequence:GTACCGGCAATCGACAATCTAGAGAAAGCTCGAGCTTTCTCTAGATTGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-940s21c1
Sequence:CCGGTGCAAGTAGCTGGCTTGTAAACTCGAGTTTACAAGCCAGCTACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-742s21c1
Sequence:CCGGTTGCTACGGTCCTCTATATTGCTCGAGCAATATAGAGGACCGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-165s21c1
Sequence:CCGGCTGGAGGTGAAGGCGCTTATTCTCGAGAATAAGCGCCTTCACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-139s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001205
VALIDATED
BNIP1 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-37s1c1
Sequence:CCGGCCGGATCTGTAACCAAGAGATCTCGAGATCTCTTGGTTACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001205.1-617s1c1
Sequence:CCGGCTTCTCATCTTCCTTGCGCTACTCGAGTAGCGCAAGGAAGATGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-323s1c1
Sequence:CCGGGCAATCGACAATCTAGAGAAACTCGAGTTTCTCTAGATTGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-101s1c1
Sequence:CCGGCGTGATTGTTCAGGACCCTTACTCGAGTAAGGGTCCTGAACAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-512s1c1
Sequence:CCGGCGAACGATCCTGGATGCAAATCTCGAGATTTGCATCCAGGATCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-418s21c1
Sequence:GTACCGGCAATCGACAATCTAGAGAAAGCTCGAGCTTTCTCTAGATTGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-940s21c1
Sequence:CCGGTGCAAGTAGCTGGCTTGTAAACTCGAGTTTACAAGCCAGCTACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-742s21c1
Sequence:CCGGTTGCTACGGTCCTCTATATTGCTCGAGCAATATAGAGGACCGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-165s21c1
Sequence:CCGGCTGGAGGTGAAGGCGCTTATTCTCGAGAATAAGCGCCTTCACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-139s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001205
VALIDATED
BNIP1 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-37s1c1
Sequence:CCGGCCGGATCTGTAACCAAGAGATCTCGAGATCTCTTGGTTACAGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_001205.1-617s1c1
Sequence:CCGGCTTCTCATCTTCCTTGCGCTACTCGAGTAGCGCAAGGAAGATGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-323s1c1
Sequence:CCGGGCAATCGACAATCTAGAGAAACTCGAGTTTCTCTAGATTGTCGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-101s1c1
Sequence:CCGGCGTGATTGTTCAGGACCCTTACTCGAGTAAGGGTCCTGAACAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001205.1-512s1c1
Sequence:CCGGCGAACGATCCTGGATGCAAATCTCGAGATTTGCATCCAGGATCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-418s21c1
Sequence:GTACCGGCAATCGACAATCTAGAGAAAGCTCGAGCTTTCTCTAGATTGTCGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230792    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-940s21c1
Sequence:CCGGTGCAAGTAGCTGGCTTGTAAACTCGAGTTTACAAGCCAGCTACTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-742s21c1
Sequence:CCGGTTGCTACGGTCCTCTATATTGCTCGAGCAATATAGAGGACCGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001205.2-165s21c1
Sequence:CCGGCTGGAGGTGAAGGCGCTTATTCTCGAGAATAAGCGCCTTCACCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001205.2-139s21c1
Sequence:CCGGGTAACCAAGAGATTGTCAAATCTCGAGATTTGACAATCTCTTGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks