EMAIL THIS PAGE TO A FRIEND

BNIP2

BCL2/adenovirus E1B 19kDa interacting protein 2

Synonyms: BNIP-2 NIP2
UniProtKB ID: Q12982, B4DS94
Gene ID:
Human(663) Summary: This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. [provided by RefSeq, Mar 2011]
Mouse(12175) BCL2/adenovirus E1B interacting protein 2
Rat(300811) BCL2/adenovirus E1B interacting protein 2
domestic guinea pig(100724901) BCL2/adenovirus E1B 19kDa interacting protein 2
naked mole-rat(101724229) BCL2/adenovirus E1B 19kDa interacting protein 2
sheep(101103240) BCL2/adenovirus E1B 19kDa interacting protein 2
Zebrafish(394197) BCL2/adenovirus E1B interacting protein 2
Horse(100068048) BCL2/adenovirus E1B 19kDa interacting protein 2
cow(516077) BCL2/adenovirus E1B 19kDa interacting protein 2
domestic cat(101101642) BCL2/adenovirus E1B 19kDa interacting protein 2
dog(487580) BCL2/adenovirus E1B 19kDa interacting protein 2
chicken(415379) BCL2/adenovirus E1B 19kDa interacting protein 2
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012711 MISSION® esiRNA esiRNA targeting mouse Bnip2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004330 Rosetta Predictions human pricing
NM_001106835 Rosetta Predictions rat pricing
NM_001008238 Rosetta Predictions mouse pricing
NM_016787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337378 predicted 481
2 SASI_Hs01_00071004 predicted 1134
3 SASI_Hs01_00071005 predicted 514
4 SASI_Hs01_00071006 predicted 1186
5 SASI_Hs01_00071008 predicted 1220
6 SASI_Hs02_00337379 predicted 1145
7 SASI_Hs01_00071003 predicted 849
8 SASI_Hs01_00071010 predicted 602
9 SASI_Hs01_00071011 predicted 1090
10 SASI_Hs02_00337380 predicted 321
11 SASI_Hs01_00071007 predicted 336
12 SASI_Hs01_00071009 predicted 528
13 SASI_Hs01_00071012 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222878 predicted 1244
2 SASI_Rn02_00222879 predicted 586
3 SASI_Rn02_00222880 predicted 1067
4 SASI_Rn02_00222881 predicted 1215
5 SASI_Rn02_00222882 predicted 935
6 SASI_Rn02_00222883 predicted 408
7 SASI_Rn02_00222884 predicted 1055
8 SASI_Rn02_00222885 predicted 791
9 SASI_Rn02_00222886 predicted 535
10 SASI_Rn02_00222887 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191560 predicted 536
2 SASI_Mm01_00191561 predicted 273
3 SASI_Mm02_00286775 predicted 195
4 SASI_Mm01_00191562 predicted 235
5 SASI_Mm01_00191563 predicted 525
6 SASI_Mm01_00191564 predicted 456
7 SASI_Mm01_00191565 predicted 283
8 SASI_Mm01_00191566 predicted 547
9 SASI_Mm01_00191567 predicted 332
10 SASI_Mm01_00191568 predicted 231
11 SASI_Mm01_00191569 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182056 predicted 779
2 SASI_Mm01_00182057 predicted 516
3 SASI_Mm01_00182058 predicted 482
4 SASI_Mm01_00182059 predicted 770
5 SASI_Mm02_00323563 predicted 696
6 SASI_Mm01_00182060 predicted 531
7 SASI_Mm01_00182061 predicted 791
8 SASI_Mm01_00182062 predicted 577
9 SASI_Mm01_00182063 predicted 438
10 SASI_Mm01_00182064 predicted 477
11 SASI_Mm01_00182065 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004330
VALIDATED
BNIP2 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-1714s21c1
Sequence:CCGGGAAGAAATATGCAGGTATATACTCGAGTATATACCTGCATATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-424s21c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-485s21c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-1148s21c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-891s21c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-330s1c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-269s1c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004330.1-902s1c1
Sequence:CCGGCAGCAAATTGATAGAAGGTTACTCGAGTAACCTTCTATCAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-993s1c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-736s1c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004330
VALIDATED
BNIP2 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-1714s21c1
Sequence:CCGGGAAGAAATATGCAGGTATATACTCGAGTATATACCTGCATATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-424s21c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-485s21c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-1148s21c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-891s21c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-330s1c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-269s1c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004330.1-902s1c1
Sequence:CCGGCAGCAAATTGATAGAAGGTTACTCGAGTAACCTTCTATCAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-993s1c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-736s1c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004330
VALIDATED
BNIP2 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-1714s21c1
Sequence:CCGGGAAGAAATATGCAGGTATATACTCGAGTATATACCTGCATATTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-424s21c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004330.2-485s21c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-1148s21c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004330.2-891s21c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-330s1c1
Sequence:CCGGGCTCACTAGAAGTTAATGGAACTCGAGTTCCATTAACTTCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-269s1c1
Sequence:CCGGCCAGAAGATGATAGTATTGAACTCGAGTTCAATACTATCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004330.1-902s1c1
Sequence:CCGGCAGCAAATTGATAGAAGGTTACTCGAGTAACCTTCTATCAATTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-993s1c1
Sequence:CCGGGACCATTTATTAGCTCGAAATCTCGAGATTTCGAGCTAATAAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004330.1-736s1c1
Sequence:CCGGGCCTGAAAGTAGTCAGCCTAACTCGAGTTAGGCTGACTACTTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016787
VALIDATED
BNIP2 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-939s1c1
Sequence:CCGGGCAAATTGATAGACGATTAAGCTCGAGCTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-1056s1c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-938s21c1
Sequence:CCGGAGCAAATTGATAGACGATTAACTCGAGTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-1056s21c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016787.3-1623s21c1
Sequence:CCGGACGTAAATAAGACCACGATTTCTCGAGAAATCGTGGTCTTATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-705s21c1
Sequence:CCGGTATTAGCCATGGAGGATATTACTCGAGTAATATCCTCCATGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-776s21c1
Sequence:CCGGAGAGTGGTCAGCCTAACTATACTCGAGTATAGTTAGGCTGACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1996s1c1
Sequence:CCGGGCTCTTAAGATGTGTTCAGTACTCGAGTACTGAACACATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1910s1c1
Sequence:CCGGGCTAGTAGTTAGGGTTTATATCTCGAGATATAAACCCTAACTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016787
VALIDATED
BNIP2 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-939s1c1
Sequence:CCGGGCAAATTGATAGACGATTAAGCTCGAGCTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-1056s1c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-938s21c1
Sequence:CCGGAGCAAATTGATAGACGATTAACTCGAGTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-1056s21c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016787.3-1623s21c1
Sequence:CCGGACGTAAATAAGACCACGATTTCTCGAGAAATCGTGGTCTTATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-705s21c1
Sequence:CCGGTATTAGCCATGGAGGATATTACTCGAGTAATATCCTCCATGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-776s21c1
Sequence:CCGGAGAGTGGTCAGCCTAACTATACTCGAGTATAGTTAGGCTGACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1996s1c1
Sequence:CCGGGCTCTTAAGATGTGTTCAGTACTCGAGTACTGAACACATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1910s1c1
Sequence:CCGGGCTAGTAGTTAGGGTTTATATCTCGAGATATAAACCCTAACTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016787
VALIDATED
BNIP2 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-939s1c1
Sequence:CCGGGCAAATTGATAGACGATTAAGCTCGAGCTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016787.3-1056s1c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-938s21c1
Sequence:CCGGAGCAAATTGATAGACGATTAACTCGAGTTAATCGTCTATCAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-1056s21c1
Sequence:CCGGGAAGATCAGATACGTCTTTAACTCGAGTTAAAGACGTATCTGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016787.3-1623s21c1
Sequence:CCGGACGTAAATAAGACCACGATTTCTCGAGAAATCGTGGTCTTATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-705s21c1
Sequence:CCGGTATTAGCCATGGAGGATATTACTCGAGTAATATCCTCCATGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_016787.3-776s21c1
Sequence:CCGGAGAGTGGTCAGCCTAACTATACTCGAGTATAGTTAGGCTGACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1996s1c1
Sequence:CCGGGCTCTTAAGATGTGTTCAGTACTCGAGTACTGAACACATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016787.2-1910s1c1
Sequence:CCGGGCTAGTAGTTAGGGTTTATATCTCGAGATATAAACCCTAACTACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks