EMAIL THIS PAGE TO A FRIEND

BNIP3

BCL2/adenovirus E1B 19kDa interacting protein 3

Synonyms: NIP3
UniProtKB ID: Q12983, O14620, Q96GP0
Gene ID:
Human(664) Summary: This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. This protein contains a BH3 domain and a transmembrane domain, which have been associated with pro-apoptotic function. The dimeric mitochondrial protein encoded by this gene is known to induce apoptosis, even in the presence of BCL2. [provided by RefSeq, Mar 2011]
Mouse(12176) BCL2/adenovirus E1B interacting protein 3
Rat(84480) BCL2/adenovirus E1B interacting protein 3
Zebrafish(336116) BCL2/adenovirus E1B interacting protein 3
cow(615342) BCL2/adenovirus E1B 19kDa interacting protein 3
domestic cat(768094) BCL2/adenovirus E1B 19kDa interacting protein 3
domestic cat(101086347) BCL2/adenovirus E1B 19kDa interacting protein 3
dog(607408) BCL2/adenovirus E1B 19kDa interacting protein 3
chicken(423971) BCL2/adenovirus E1B 19kDa interacting protein 3
sheep(101108441) BCL2/adenovirus E1B 19kDa interacting protein 3
naked mole-rat(101709429) BCL2/adenovirus E1B 19kDa interacting protein 3
domestic guinea pig(100730418) BCL2/adenovirus E1B 19kDa interacting protein 3
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004052 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004052 Rosetta Predictions human pricing
NM_053420 Rosetta Predictions rat pricing
NM_009760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131554 predicted 558
2 SASI_Hs01_00131555 predicted 291
3 SASI_Hs01_00131557 predicted 224
4 SASI_Hs01_00131559 predicted 665
5 SASI_Hs01_00131560 predicted 276
6 SASI_Hs01_00131561 predicted 395
7 SASI_Hs01_00131562 predicted 712
8 SASI_Hs02_00336823 predicted 724
9 SASI_Hs01_00131563 predicted 681
10 SASI_Hs02_00336824 predicted 587
11 SASI_Hs01_00131556 predicted 468
12 SASI_Hs01_00131558 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053307 predicted 679
2 SASI_Rn02_00265961 predicted 404
3 SASI_Rn01_00053308 predicted 805
4 SASI_Rn01_00053309 predicted 792
5 SASI_Rn01_00053310 predicted 618
6 SASI_Rn01_00053312 predicted 569
7 SASI_Rn01_00053313 predicted 846
8 SASI_Rn02_00265962 predicted 741
9 SASI_Rn01_00053314 predicted 599
10 SASI_Rn01_00053315 predicted 479
11 SASI_Rn01_00053311 predicted 781
12 SASI_Rn01_00053316 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115985 predicted 312
2 SASI_Mm01_00115986 predicted 247
3 SASI_Mm02_00316951 predicted 362
4 SASI_Mm01_00115987 predicted 259
5 SASI_Mm01_00115988 predicted 504
6 SASI_Mm01_00115989 predicted 622
7 SASI_Mm01_00115990 predicted 379
8 SASI_Mm01_00115991 predicted 423
9 SASI_Mm01_00115992 predicted 673
10 SASI_Mm01_00115993 predicted 652
11 SASI_Mm01_00115994 predicted 657
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009760
VALIDATED
BNIP3 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009760.2-810s1c1
Sequence:CCGGCCTGAATTAGTGAGACAGAATCTCGAGATTCTGTCTCACTAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009760.2-524s1c1
Sequence:CCGGGCATGAGAAACACAAGCGTTACTCGAGTAACGCTTGTGTTTCTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-405s1c1
Sequence:CCGGAGAAGTTGAAAGTATCCTGAACTCGAGTTCAGGATACTTTCAACTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-245s1c1
Sequence:CCGGCCCAGCATGAATCTGGACGAACTCGAGTTCGTCCAGATTCATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-592s1c1
Sequence:CCGGCCATCTCTGTTACTGTCTCATCTCGAGATGAGACAGTAACAGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-438s21c1
Sequence:CCGGTGGATATGGGATTGGTCAAGTCTCGAGACTTGACCAATCCCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1465s21c1
Sequence:CCGGAGGATCCAAAGCTGCTTAAATCTCGAGATTTAAGCAGCTTTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-319s21c1
Sequence:GTACCGGATACCAACAGAGCTGAAATAGCTCGAGCTATTTCAGCTCTGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-666s21c1
Sequence:GTACCGGAGCACCTTCTGATGAAGATTTCTCGAGAAATCTTCATCAGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1570s21c1
Sequence:CCGGGTTTCACTGTCCCACACTTAACTCGAGTTAAGTGTGGGACAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-852s21c1
Sequence:CCGGTTATACCTATGGGATCAATTACTCGAGTAATTGATCCCATAGGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-370s21c1
Sequence:CCGGCTCTGTCTGAGGAAGATTATACTCGAGTATAATCTTCCTCAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-189s21c1
Sequence:CCGGGTTCCAGCCTCCGTCTCTATTCTCGAGAATAGAGACGGAGGCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009760
VALIDATED
BNIP3 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009760.2-810s1c1
Sequence:CCGGCCTGAATTAGTGAGACAGAATCTCGAGATTCTGTCTCACTAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009760.2-524s1c1
Sequence:CCGGGCATGAGAAACACAAGCGTTACTCGAGTAACGCTTGTGTTTCTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-405s1c1
Sequence:CCGGAGAAGTTGAAAGTATCCTGAACTCGAGTTCAGGATACTTTCAACTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-245s1c1
Sequence:CCGGCCCAGCATGAATCTGGACGAACTCGAGTTCGTCCAGATTCATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-592s1c1
Sequence:CCGGCCATCTCTGTTACTGTCTCATCTCGAGATGAGACAGTAACAGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-438s21c1
Sequence:CCGGTGGATATGGGATTGGTCAAGTCTCGAGACTTGACCAATCCCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1465s21c1
Sequence:CCGGAGGATCCAAAGCTGCTTAAATCTCGAGATTTAAGCAGCTTTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-319s21c1
Sequence:GTACCGGATACCAACAGAGCTGAAATAGCTCGAGCTATTTCAGCTCTGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-666s21c1
Sequence:GTACCGGAGCACCTTCTGATGAAGATTTCTCGAGAAATCTTCATCAGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1570s21c1
Sequence:CCGGGTTTCACTGTCCCACACTTAACTCGAGTTAAGTGTGGGACAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-852s21c1
Sequence:CCGGTTATACCTATGGGATCAATTACTCGAGTAATTGATCCCATAGGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-370s21c1
Sequence:CCGGCTCTGTCTGAGGAAGATTATACTCGAGTATAATCTTCCTCAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-189s21c1
Sequence:CCGGGTTCCAGCCTCCGTCTCTATTCTCGAGAATAGAGACGGAGGCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009760
VALIDATED
BNIP3 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009760.2-810s1c1
Sequence:CCGGCCTGAATTAGTGAGACAGAATCTCGAGATTCTGTCTCACTAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009760.2-524s1c1
Sequence:CCGGGCATGAGAAACACAAGCGTTACTCGAGTAACGCTTGTGTTTCTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-405s1c1
Sequence:CCGGAGAAGTTGAAAGTATCCTGAACTCGAGTTCAGGATACTTTCAACTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-245s1c1
Sequence:CCGGCCCAGCATGAATCTGGACGAACTCGAGTTCGTCCAGATTCATGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009760.2-592s1c1
Sequence:CCGGCCATCTCTGTTACTGTCTCATCTCGAGATGAGACAGTAACAGAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-438s21c1
Sequence:CCGGTGGATATGGGATTGGTCAAGTCTCGAGACTTGACCAATCCCATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1465s21c1
Sequence:CCGGAGGATCCAAAGCTGCTTAAATCTCGAGATTTAAGCAGCTTTGGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-319s21c1
Sequence:GTACCGGATACCAACAGAGCTGAAATAGCTCGAGCTATTTCAGCTCTGTTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-666s21c1
Sequence:GTACCGGAGCACCTTCTGATGAAGATTTCTCGAGAAATCTTCATCAGAAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-1570s21c1
Sequence:CCGGGTTTCACTGTCCCACACTTAACTCGAGTTAAGTGTGGGACAGTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229457    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009760.4-852s21c1
Sequence:CCGGTTATACCTATGGGATCAATTACTCGAGTAATTGATCCCATAGGTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-370s21c1
Sequence:CCGGCTCTGTCTGAGGAAGATTATACTCGAGTATAATCTTCCTCAGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009760.4-189s21c1
Sequence:CCGGGTTCCAGCCTCCGTCTCTATTCTCGAGAATAGAGACGGAGGCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004052
VALIDATED
BNIP3 MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-636s1c1
Sequence:CCGGGCTCTCTCATTTGCTGGCCATCTCGAGATGGCCAGCAAATGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-184s1c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-361s1c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-226s1c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-800s1c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-226s21c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-800s21c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004052.2-184s21c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-361s21c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004052
VALIDATED
BNIP3 MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-636s1c1
Sequence:CCGGGCTCTCTCATTTGCTGGCCATCTCGAGATGGCCAGCAAATGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-184s1c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-361s1c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-226s1c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-800s1c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-226s21c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-800s21c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004052.2-184s21c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-361s21c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004052
VALIDATED
BNIP3 MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-636s1c1
Sequence:CCGGGCTCTCTCATTTGCTGGCCATCTCGAGATGGCCAGCAAATGAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-184s1c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-361s1c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-226s1c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004052.2-800s1c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-226s21c1
Sequence:CCGGGCCTCGGTTTCTATTTATAATCTCGAGATTATAAATAGAAACCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-800s21c1
Sequence:CCGGGCCACGTCACTTGTGTTTATTCTCGAGAATAAACACAAGTGACGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004052.2-184s21c1
Sequence:CCGGGAACTGCACTTCAGCAATAATCTCGAGATTATTGCTGAAGTGCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004052.2-361s21c1
Sequence:CCGGGCTTCTGAAACAGATACCCATCTCGAGATGGGTATCTGTTTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks