EMAIL THIS PAGE TO A FRIEND

BNIP3L

BCL2/adenovirus E1B 19kDa interacting protein 3-like

232 Gene Product Result for
Synonyms: BNIP3a NIX
UniProtKB ID: O60238, Q5JW63, Q8NF87
Gene ID:
Human(665) Summary: This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. This protein counteracts the apoptotic inducer BNIP3 and may play a role in tumor suppression. [provided by RefSeq, Mar 2011]
Mouse(12177) BCL2/adenovirus E1B interacting protein 3-like
Rat(140923) BCL2/adenovirus E1B interacting protein 3-like
domestic guinea pig(100733852) BCL2/adenovirus E1B 19kDa interacting protein 3-like
naked mole-rat(101709497) BCL2/adenovirus E1B 19kDa interacting protein 3-like
sheep(101110026) BCL2/adenovirus E1B 19kDa interacting protein 3-like
chicken(419522) BCL2/adenovirus E1B 19kDa interacting protein 3-like
dog(608552) BCL2/adenovirus E1B 19kDa interacting protein 3-like
cow(534615) BCL2/adenovirus E1B 19kDa interacting protein 3-like
domestic cat(101099293) BCL2/adenovirus E1B 19kDa interacting protein 3-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004331 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004331 Rosetta Predictions human pricing
NM_080888 Rosetta Predictions rat pricing
NM_009761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030000 predicted 1003
2 SASI_Hs01_00030001 predicted 811
3 SASI_Hs01_00030002 predicted 598
4 SASI_Hs01_00030003 predicted 796
5 SASI_Hs01_00030004 predicted 796
6 SASI_Hs01_00030005 predicted 595
7 SASI_Hs01_00030006 predicted 356
8 SASI_Hs01_00030007 predicted 821
9 SASI_Hs01_00030008 predicted 898
10 SASI_Hs02_00337381 predicted 352
11 SASI_Hs01_00029999 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267340 predicted 488
2 SASI_Rn01_00103620 predicted 690
3 SASI_Rn01_00103621 predicted 358
4 SASI_Rn01_00103622 predicted 652
5 SASI_Rn01_00103623 predicted 406
6 SASI_Rn01_00103624 predicted 784
7 SASI_Rn01_00103626 predicted 778
8 SASI_Rn01_00103627 predicted 289
9 SASI_Rn01_00103628 predicted 253
10 SASI_Rn01_00103629 predicted 772
11 SASI_Rn01_00103625 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038852 predicted 774
2 SASI_Mm01_00038854 predicted 965
3 SASI_Mm02_00316952 predicted 855
4 SASI_Mm01_00038856 predicted 566
5 SASI_Mm01_00038857 predicted 933
6 SASI_Mm02_00316953 predicted 962
7 SASI_Mm01_00038861 predicted 854
8 SASI_Mm02_00316954 predicted 958
9 SASI_Mm02_00316955 predicted 783
10 SASI_Mm02_00316956 predicted 802
11 SASI_Mm01_00038853 predicted 393
12 SASI_Mm01_00038855 predicted 456
13 SASI_Mm01_00038858 predicted 756
14 SASI_Mm01_00038859 predicted 354
15 SASI_Mm01_00038860 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009761
BNIP3L MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009761.3-1012s21c1
Sequence:CCGGCAATGCCACCAGCAGATTATACTCGAGTATAATCTGCTGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009761.3-573s21c1
Sequence:CCGGTAAACGTGCTGCGTCTCTAAGCTCGAGCTTAGAGACGCAGCACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009761.2-1939s1c1
Sequence:CCGGGCGGATTATCTCAAGTAGATTCTCGAGAATCTACTTGAGATAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-168s1c1
Sequence:CCGGGCAATGGCAATGAGAATGGAACTCGAGTTCCATTCTCATTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-338s1c1
Sequence:CCGGGATGGGCAGATCATGTTTGATCTCGAGATCAAACATGATCTGCCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-490s1c1
Sequence:CCGGCCCACCCAAAGAGTTCCATTTCTCGAGAAATGGAACTCTTTGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-643s1c1
Sequence:CCGGGCTCGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009761
BNIP3L MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009761.3-1012s21c1
Sequence:CCGGCAATGCCACCAGCAGATTATACTCGAGTATAATCTGCTGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009761.3-573s21c1
Sequence:CCGGTAAACGTGCTGCGTCTCTAAGCTCGAGCTTAGAGACGCAGCACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009761.2-1939s1c1
Sequence:CCGGGCGGATTATCTCAAGTAGATTCTCGAGAATCTACTTGAGATAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-168s1c1
Sequence:CCGGGCAATGGCAATGAGAATGGAACTCGAGTTCCATTCTCATTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-338s1c1
Sequence:CCGGGATGGGCAGATCATGTTTGATCTCGAGATCAAACATGATCTGCCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-490s1c1
Sequence:CCGGCCCACCCAAAGAGTTCCATTTCTCGAGAAATGGAACTCTTTGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-643s1c1
Sequence:CCGGGCTCGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009761
BNIP3L MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009761.3-1012s21c1
Sequence:CCGGCAATGCCACCAGCAGATTATACTCGAGTATAATCTGCTGGTGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009761.3-573s21c1
Sequence:CCGGTAAACGTGCTGCGTCTCTAAGCTCGAGCTTAGAGACGCAGCACGTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009761.2-1939s1c1
Sequence:CCGGGCGGATTATCTCAAGTAGATTCTCGAGAATCTACTTGAGATAATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-168s1c1
Sequence:CCGGGCAATGGCAATGAGAATGGAACTCGAGTTCCATTCTCATTGCCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-338s1c1
Sequence:CCGGGATGGGCAGATCATGTTTGATCTCGAGATCAAACATGATCTGCCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-490s1c1
Sequence:CCGGCCCACCCAAAGAGTTCCATTTCTCGAGAAATGGAACTCTTTGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009761.2-643s1c1
Sequence:CCGGGCTCGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004331
VALIDATED
BNIP3L MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-730s21c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-434s21c1
Sequence:CCGGATCATGTTTGATGTGGAAATGCTCGAGCATTTCCACATCAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-309s21c1
Sequence:CCGGCCTCATCCTCCATCCACAATGCTCGAGCATTGTGGATGGAGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004331.2-831s21c1
Sequence:CCGGTATTGTCACAGTAGCTTATTTCTCGAGAAATAAGCTACTGTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-479s21c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-437s1c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-688s1c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004331.1-562s1c1
Sequence:CCGGCCCTAAACGTTCTGTGTCTTTCTCGAGAAAGACACAGAACGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004331.1-1040s1c1
Sequence:CCGGCGGCAATGCTATTATCTCTAACTCGAGTTAGAGATAATAGCATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004331.1-220s1c1
Sequence:CCGGCAATGATAATGGCAATGGGAACTCGAGTTCCCATTGCCATTATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004331
VALIDATED
BNIP3L MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-730s21c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-434s21c1
Sequence:CCGGATCATGTTTGATGTGGAAATGCTCGAGCATTTCCACATCAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-309s21c1
Sequence:CCGGCCTCATCCTCCATCCACAATGCTCGAGCATTGTGGATGGAGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004331.2-831s21c1
Sequence:CCGGTATTGTCACAGTAGCTTATTTCTCGAGAAATAAGCTACTGTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-479s21c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-437s1c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-688s1c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004331.1-562s1c1
Sequence:CCGGCCCTAAACGTTCTGTGTCTTTCTCGAGAAAGACACAGAACGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004331.1-1040s1c1
Sequence:CCGGCGGCAATGCTATTATCTCTAACTCGAGTTAGAGATAATAGCATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004331.1-220s1c1
Sequence:CCGGCAATGATAATGGCAATGGGAACTCGAGTTCCCATTGCCATTATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004331
VALIDATED
BNIP3L MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kDa interacting protein 3-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-730s21c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-434s21c1
Sequence:CCGGATCATGTTTGATGTGGAAATGCTCGAGCATTTCCACATCAAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-309s21c1
Sequence:CCGGCCTCATCCTCCATCCACAATGCTCGAGCATTGTGGATGGAGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004331.2-831s21c1
Sequence:CCGGTATTGTCACAGTAGCTTATTTCTCGAGAAATAAGCTACTGTGACAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004331.2-479s21c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-437s1c1
Sequence:CCGGCAGTCAGAAGAAGAAGTTGTACTCGAGTACAACTTCTTCTTCTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004331.1-688s1c1
Sequence:CCGGGCTAGGCATCTATATTGGAAACTCGAGTTTCCAATATAGATGCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_004331.1-562s1c1
Sequence:CCGGCCCTAAACGTTCTGTGTCTTTCTCGAGAAAGACACAGAACGTTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004331.1-1040s1c1
Sequence:CCGGCGGCAATGCTATTATCTCTAACTCGAGTTAGAGATAATAGCATTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004331.1-220s1c1
Sequence:CCGGCAATGATAATGGCAATGGGAACTCGAGTTCCCATTGCCATTATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks