EMAIL THIS PAGE TO A FRIEND

BNIPL

BCL2/adenovirus E1B 19kD interacting protein like

82 Gene Product Result for
Synonyms: BNIP-S BNIPL-1 BNIPL-2 BNIPL1 BNIPL2 BNIPS PP753
UniProtKB ID: Q7Z465, Q6DK43, Q8TCY7, Q8WYG2
Gene ID:
Human(149428) Summary: The protein encoded by this gene interacts with several other proteins, such as BCL2, ARHGAP1, MIF and GFER. It may function as a bridge molecule between BCL2 and ARHGAP1/CDC42 in promoting cell death. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(171388) BCL2/adenovirus E1B 19kD interacting protein like
Rat(361994) BCL2/adenovirus E1B 19kD interacting protein like
Zebrafish(100149386) BCL2/adenovirus E1B 19kD interacting protein, like
cow(614493) BCL2/adenovirus E1B 19kD interacting protein like
domestic cat(101095356) BCL2/adenovirus E1B 19kD interacting protein like
dog(483190) BCL2/adenovirus E1B 19kD interacting protein like
domestic guinea pig(100723047) BCL2/adenovirus E1B 19kD interacting protein like
naked mole-rat(101710595) BCL2/adenovirus E1B 19kD interacting protein like
sheep(101110283) BCL2/adenovirus E1B 19kD interacting protein like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138278 Rosetta Predictions human pricing
NM_138279 Rosetta Predictions human pricing
NM_001128187 Rosetta Predictions rat pricing
XM_342294 Rosetta Predictions rat pricing
NM_134253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363346 predicted 792
2 SASI_Hs02_00363347 predicted 737
3 SASI_Hs02_00363348 predicted 1098
4 SASI_Hs02_00363349 predicted 853
5 SASI_Hs02_00363350 predicted 975
6 SASI_Hs02_00363351 predicted 428
7 SASI_Hs02_00363352 predicted 801
8 SASI_Hs02_00363353 predicted 1228
9 SASI_Hs02_00363354 predicted 536
10 SASI_Hs02_00363355 predicted 867
11 SASI_Hs01_00157881 predicted 1002
12 SASI_Hs01_00157882 predicted 830
13 SASI_Hs01_00157883 predicted 863
14 SASI_Hs01_00157884 predicted 999
15 SASI_Hs01_00157885 predicted 862
16 SASI_Hs01_00157886 predicted 939
17 SASI_Hs01_00157887 predicted 898
18 SASI_Hs01_00157888 predicted 850
19 SASI_Hs01_00157889 predicted 924
20 SASI_Hs01_00157890 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176190 predicted 389
2 SASI_Hs01_00176191 predicted 220
3 SASI_Hs01_00176192 predicted 239
4 SASI_Hs01_00176193 predicted 377
5 SASI_Hs01_00176194 predicted 248
6 SASI_Hs01_00176195 predicted 322
7 SASI_Hs01_00176196 predicted 281
8 SASI_Hs01_00176197 predicted 237
9 SASI_Hs01_00176198 predicted 307
10 SASI_Hs01_00176199 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255050 predicted 747
2 SASI_Rn02_00255051 predicted 1161
3 SASI_Rn02_00255052 predicted 967
4 SASI_Rn02_00255053 predicted 1165
5 SASI_Rn02_00255054 predicted 989
6 SASI_Rn02_00255055 predicted 1233
7 SASI_Rn02_00255056 predicted 620
8 SASI_Rn02_00255057 predicted 1253
9 SASI_Rn02_00255058 predicted 1054
10 SASI_Rn02_00255059 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188349 predicted 807
2 SASI_Rn01_00188350 predicted 825
3 SASI_Rn01_00188351 predicted 826
4 SASI_Rn01_00188352 predicted 762
5 SASI_Rn01_00188353 predicted 828
6 SASI_Rn01_00188354 predicted 816
7 SASI_Rn01_00188355 predicted 842
8 SASI_Rn01_00188356 predicted 815
9 SASI_Rn01_00188357 predicted 814
10 SASI_Rn01_00188358 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080483 predicted 809
2 SASI_Mm01_00080484 predicted 665
3 SASI_Mm01_00080486 predicted 313
4 SASI_Mm01_00080487 predicted 785
5 SASI_Mm01_00080488 predicted 779
6 SASI_Mm01_00080489 predicted 665
7 SASI_Mm01_00080490 predicted 496
8 SASI_Mm01_00080491 predicted 1281
9 SASI_Mm01_00080492 predicted 207
10 SASI_Mm02_00339559 predicted 791
11 SASI_Mm01_00080485 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138278
BNIPL MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kD interacting protein like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138278.1-1502s1c1
Sequence:CCGGCCTGAAACATCTGAACTGTTTCTCGAGAAACAGTTCAGATGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1298s1c1
Sequence:CCGGGCCCTTCATCAGTTCCAAATTCTCGAGAATTTGGAACTGATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1003s1c1
Sequence:CCGGGCCTCAATGCTGTCATCCTTTCTCGAGAAAGGATGACAGCATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1256s1c1
Sequence:CCGGCCATGCTACATGGTATGTGAACTCGAGTTCACATACCATGTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-936s1c1
Sequence:CCGGCGCGTAGACATGACTGTCATTCTCGAGAATGACAGTCATGTCTACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-879s21c1
Sequence:CCGGGAACACTTGTTTAGGTATATGCTCGAGCATATACCTAAACAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-531s21c1
Sequence:CCGGGACCTGGAGATAGACGAATTGCTCGAGCAATTCGTCTATCTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138278.3-1387s21c1
Sequence:CCGGCCTTTGCATGACCCTACTTTCCTCGAGGAAAGTAGGGTCATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-1243s21c1
Sequence:CCGGCATAGCACAGGACTGGATAAACTCGAGTTTATCCAGTCCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138278
BNIPL MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kD interacting protein like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138278.1-1502s1c1
Sequence:CCGGCCTGAAACATCTGAACTGTTTCTCGAGAAACAGTTCAGATGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1298s1c1
Sequence:CCGGGCCCTTCATCAGTTCCAAATTCTCGAGAATTTGGAACTGATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1003s1c1
Sequence:CCGGGCCTCAATGCTGTCATCCTTTCTCGAGAAAGGATGACAGCATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1256s1c1
Sequence:CCGGCCATGCTACATGGTATGTGAACTCGAGTTCACATACCATGTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-936s1c1
Sequence:CCGGCGCGTAGACATGACTGTCATTCTCGAGAATGACAGTCATGTCTACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-879s21c1
Sequence:CCGGGAACACTTGTTTAGGTATATGCTCGAGCATATACCTAAACAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-531s21c1
Sequence:CCGGGACCTGGAGATAGACGAATTGCTCGAGCAATTCGTCTATCTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138278.3-1387s21c1
Sequence:CCGGCCTTTGCATGACCCTACTTTCCTCGAGGAAAGTAGGGTCATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-1243s21c1
Sequence:CCGGCATAGCACAGGACTGGATAAACTCGAGTTTATCCAGTCCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138278
BNIPL MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kD interacting protein like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138278.1-1502s1c1
Sequence:CCGGCCTGAAACATCTGAACTGTTTCTCGAGAAACAGTTCAGATGTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1298s1c1
Sequence:CCGGGCCCTTCATCAGTTCCAAATTCTCGAGAATTTGGAACTGATGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1003s1c1
Sequence:CCGGGCCTCAATGCTGTCATCCTTTCTCGAGAAAGGATGACAGCATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-1256s1c1
Sequence:CCGGCCATGCTACATGGTATGTGAACTCGAGTTCACATACCATGTAGCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138278.1-936s1c1
Sequence:CCGGCGCGTAGACATGACTGTCATTCTCGAGAATGACAGTCATGTCTACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-879s21c1
Sequence:CCGGGAACACTTGTTTAGGTATATGCTCGAGCATATACCTAAACAAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-531s21c1
Sequence:CCGGGACCTGGAGATAGACGAATTGCTCGAGCAATTCGTCTATCTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138278.3-1387s21c1
Sequence:CCGGCCTTTGCATGACCCTACTTTCCTCGAGGAAAGTAGGGTCATGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138278.3-1243s21c1
Sequence:CCGGCATAGCACAGGACTGGATAAACTCGAGTTTATCCAGTCCTGTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134253
BNIPL MISSION shRNA Bacterial Glycerol Stock
BCL2/adenovirus E1B 19kD interacting protein like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-740s1c1
Sequence:CCGGCTCTTTGCTTCCTGCTATCTACTCGAGTAGATAGCAGGAAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-808s1c1
Sequence:CCGGCAGGTATATGGTGGGAACTTTCTCGAGAAAGTTCCCACCATATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-1036s1c1
Sequence:CCGGGTTCACACGAAAGATCCGCTTCTCGAGAAGCGGATCTTTCGTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-786s1c1
Sequence:CCGGCCTACATCATGGAACACTTATCTCGAGATAAGTGTTCCATGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-1092s21c1
Sequence:CCGGCGTTAGAGCAAGTGCACATACCTCGAGGTATGTGCACTTGCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-797s21c1
Sequence:CCGGGAACACTTATTCAGGTATATGCTCGAGCATATACCTGAATAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-615s21c1
Sequence:CCGGGTCATCGCTGGAGAGTGTTTCCTCGAGGAAACACTCTCCAGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134253.1-1301s21c1
Sequence:CCGGTGCCTTCAAGCTGGGATTTAACTCGAGTTAAATCCCAGCTTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134253
BNIPL MISSION shRNA shRNA Plasmid DNA
BCL2/adenovirus E1B 19kD interacting protein like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-740s1c1
Sequence:CCGGCTCTTTGCTTCCTGCTATCTACTCGAGTAGATAGCAGGAAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-808s1c1
Sequence:CCGGCAGGTATATGGTGGGAACTTTCTCGAGAAAGTTCCCACCATATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-1036s1c1
Sequence:CCGGGTTCACACGAAAGATCCGCTTCTCGAGAAGCGGATCTTTCGTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-786s1c1
Sequence:CCGGCCTACATCATGGAACACTTATCTCGAGATAAGTGTTCCATGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-1092s21c1
Sequence:CCGGCGTTAGAGCAAGTGCACATACCTCGAGGTATGTGCACTTGCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-797s21c1
Sequence:CCGGGAACACTTATTCAGGTATATGCTCGAGCATATACCTGAATAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-615s21c1
Sequence:CCGGGTCATCGCTGGAGAGTGTTTCCTCGAGGAAACACTCTCCAGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134253.1-1301s21c1
Sequence:CCGGTGCCTTCAAGCTGGGATTTAACTCGAGTTAAATCCCAGCTTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134253
BNIPL MISSION shRNA Lentiviral Transduction Particles
BCL2/adenovirus E1B 19kD interacting protein like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-740s1c1
Sequence:CCGGCTCTTTGCTTCCTGCTATCTACTCGAGTAGATAGCAGGAAGCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-808s1c1
Sequence:CCGGCAGGTATATGGTGGGAACTTTCTCGAGAAAGTTCCCACCATATACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-1036s1c1
Sequence:CCGGGTTCACACGAAAGATCCGCTTCTCGAGAAGCGGATCTTTCGTGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134253.1-786s1c1
Sequence:CCGGCCTACATCATGGAACACTTATCTCGAGATAAGTGTTCCATGATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-1092s21c1
Sequence:CCGGCGTTAGAGCAAGTGCACATACCTCGAGGTATGTGCACTTGCTCTAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-797s21c1
Sequence:CCGGGAACACTTATTCAGGTATATGCTCGAGCATATACCTGAATAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134253.1-615s21c1
Sequence:CCGGGTCATCGCTGGAGAGTGTTTCCTCGAGGAAACACTCTCCAGCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134253.1-1301s21c1
Sequence:CCGGTGCCTTCAAGCTGGGATTTAACTCGAGTTAAATCCCAGCTTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks