EMAIL THIS PAGE TO A FRIEND

BOC

BOC cell adhesion associated, oncogene regulated

95 Gene Product Result for
Synonyms: CDON2
Gene ID:
Human(91653) Summary: The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. [provided by RefSeq, Sep 2011]
Mouse(117606) biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Rat(360715) BOC cell adhesion associated, oncogene regulated
Zebrafish(334628) brother of CDO
domestic cat(101089887) Boc homolog (mouse)
cow(512018) Boc homolog (mouse)
Horse(100071428) Boc homolog (mouse)
dog(487979) Boc homolog (mouse)
chicken(418361) Boc homolog (mouse)
naked mole-rat(101720114) BOC cell adhesion associated, oncogene regulated
domestic guinea pig(100712740) BOC cell adhesion associated, oncogene regulated
sheep(101123082) Boc homolog (mouse)
Domestic Rabbit(100347510) Boc homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1291 Human BOC ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033254 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159151 MISSION® esiRNA esiRNA human BOC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033254 Rosetta Predictions human pricing
NM_001108317 Rosetta Predictions rat pricing
NM_172506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361050 predicted 1860
2 SASI_Hs01_00067724 predicted 3043
3 SASI_Hs01_00067725 predicted 2519
4 SASI_Hs01_00067726 predicted 3128
5 SASI_Hs01_00067727 predicted 2758
6 SASI_Hs01_00067728 predicted 851
7 SASI_Hs01_00067730 predicted 2333
8 SASI_Hs01_00067731 predicted 2994
9 SASI_Hs01_00067732 predicted 367
10 SASI_Hs02_00361051 predicted 2694
11 SASI_Hs01_00067729 predicted 716
12 SASI_Hs01_00067733 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237469 predicted 956
2 SASI_Rn02_00237470 predicted 927
3 SASI_Rn02_00237471 predicted 757
4 SASI_Rn02_00237472 predicted 738
5 SASI_Rn02_00237473 predicted 896
6 SASI_Rn02_00237474 predicted 942
7 SASI_Rn02_00237475 predicted 938
8 SASI_Rn02_00237476 predicted 883
9 SASI_Rn02_00237477 predicted 702
10 SASI_Rn02_00237478 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117031 predicted 544
2 SASI_Mm01_00117032 predicted 2222
3 SASI_Mm01_00117033 predicted 3859
4 SASI_Mm01_00117034 predicted 2694
5 SASI_Mm01_00117035 predicted 3621
6 SASI_Mm01_00117036 predicted 3159
7 SASI_Mm01_00117037 predicted 3641
8 SASI_Mm01_00117038 predicted 3689
9 SASI_Mm01_00117040 predicted 3445
10 SASI_Mm02_00344094 predicted 2682
11 SASI_Mm01_00117039 predicted 3145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172506
BOC MISSION shRNA Bacterial Glycerol Stock
BOC cell adhesion associated, oncogene regulated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-886s21c1
Sequence:CCGGGCCAATCTCCAGGACTTTAAACTCGAGTTTAAAGTCCTGGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2619s21c1
Sequence:CCGGAGGCTACAGTGGCCGTGTATACTCGAGTATACACGGCCACTGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2682s21c1
Sequence:CCGGAGTCAATGAGACCACTATTATCTCGAGATAATAGTGGTCTCATTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172506.2-4189s21c1
Sequence:CCGGATGAAGAACACAGGGATAAAGCTCGAGCTTTATCCCTGTGTTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172506.1-3864s1c1
Sequence:CCGGCCGAAGCTAATATCCCAGAAACTCGAGTTTCTGGGATATTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-2935s1c1
Sequence:CCGGCGAGACCAAAGCTCGGAAATTCTCGAGAATTTCCGAGCTTTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3863s1c1
Sequence:CCGGGCCGAAGCTAATATCCCAGAACTCGAGTTCTGGGATATTAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3436s1c1
Sequence:CCGGGCCCATTGTTAGCAACGGATACTCGAGTATCCGTTGCTAACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3220s1c1
Sequence:CCGGCCAGTACACAATGGTGCCATTCTCGAGAATGGCACCATTGTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172506
BOC MISSION shRNA shRNA Plasmid DNA
BOC cell adhesion associated, oncogene regulated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-886s21c1
Sequence:CCGGGCCAATCTCCAGGACTTTAAACTCGAGTTTAAAGTCCTGGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2619s21c1
Sequence:CCGGAGGCTACAGTGGCCGTGTATACTCGAGTATACACGGCCACTGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2682s21c1
Sequence:CCGGAGTCAATGAGACCACTATTATCTCGAGATAATAGTGGTCTCATTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172506.2-4189s21c1
Sequence:CCGGATGAAGAACACAGGGATAAAGCTCGAGCTTTATCCCTGTGTTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172506.1-3864s1c1
Sequence:CCGGCCGAAGCTAATATCCCAGAAACTCGAGTTTCTGGGATATTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-2935s1c1
Sequence:CCGGCGAGACCAAAGCTCGGAAATTCTCGAGAATTTCCGAGCTTTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3863s1c1
Sequence:CCGGGCCGAAGCTAATATCCCAGAACTCGAGTTCTGGGATATTAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3436s1c1
Sequence:CCGGGCCCATTGTTAGCAACGGATACTCGAGTATCCGTTGCTAACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3220s1c1
Sequence:CCGGCCAGTACACAATGGTGCCATTCTCGAGAATGGCACCATTGTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172506
BOC MISSION shRNA Lentiviral Transduction Particles
BOC cell adhesion associated, oncogene regulated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-886s21c1
Sequence:CCGGGCCAATCTCCAGGACTTTAAACTCGAGTTTAAAGTCCTGGAGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2619s21c1
Sequence:CCGGAGGCTACAGTGGCCGTGTATACTCGAGTATACACGGCCACTGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172506.2-2682s21c1
Sequence:CCGGAGTCAATGAGACCACTATTATCTCGAGATAATAGTGGTCTCATTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172506.2-4189s21c1
Sequence:CCGGATGAAGAACACAGGGATAAAGCTCGAGCTTTATCCCTGTGTTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172506.1-3864s1c1
Sequence:CCGGCCGAAGCTAATATCCCAGAAACTCGAGTTTCTGGGATATTAGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-2935s1c1
Sequence:CCGGCGAGACCAAAGCTCGGAAATTCTCGAGAATTTCCGAGCTTTGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3863s1c1
Sequence:CCGGGCCGAAGCTAATATCCCAGAACTCGAGTTCTGGGATATTAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3436s1c1
Sequence:CCGGGCCCATTGTTAGCAACGGATACTCGAGTATCCGTTGCTAACAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172506.1-3220s1c1
Sequence:CCGGCCAGTACACAATGGTGCCATTCTCGAGAATGGCACCATTGTGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033254
VALIDATED
BOC MISSION shRNA Bacterial Glycerol Stock
BOC cell adhesion associated, oncogene regulated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-734s21c1
Sequence:CCGGTAGATGTGCAGCACGTGATTGCTCGAGCAATCACGTGCTGCACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033254.2-1786s21c1
Sequence:CCGGACCTCCAAGACAGACTCATATCTCGAGATATGAGTCTGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033254.2-3695s21c1
Sequence:CCGGATATCCCAGAAAGACTATATACTCGAGTATATAGTCTTTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-2686s21c1
Sequence:CCGGGAGACCTCCTACGACATTAAGCTCGAGCTTAATGTCGTAGGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-3664s21c1
Sequence:CCGGACACCACCTCTCACAATTTAGCTCGAGCTAAATTGTGAGAGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033254.2-4140s1c1
Sequence:CCGGCCCATGAGAACAGACCAAGATCTCGAGATCTTGGTCTGTTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-763s1c1
Sequence:CCGGGAGGGAAACACAGCAGTCATTCTCGAGAATGACTGCTGTGTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-1278s1c1
Sequence:CCGGCCTCTACAATGTCCAGGTGTTCTCGAGAACACCTGGACATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-3042s1c1
Sequence:CCGGCCCGTATACTATGGTGCCATTCTCGAGAATGGCACCATAGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-2697s1c1
Sequence:CCGGCGACATTAAGATGCAGTGCTTCTCGAGAAGCACTGCATCTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033254
VALIDATED
BOC MISSION shRNA shRNA Plasmid DNA
BOC cell adhesion associated, oncogene regulated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-734s21c1
Sequence:CCGGTAGATGTGCAGCACGTGATTGCTCGAGCAATCACGTGCTGCACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033254.2-1786s21c1
Sequence:CCGGACCTCCAAGACAGACTCATATCTCGAGATATGAGTCTGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033254.2-3695s21c1
Sequence:CCGGATATCCCAGAAAGACTATATACTCGAGTATATAGTCTTTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-2686s21c1
Sequence:CCGGGAGACCTCCTACGACATTAAGCTCGAGCTTAATGTCGTAGGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-3664s21c1
Sequence:CCGGACACCACCTCTCACAATTTAGCTCGAGCTAAATTGTGAGAGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033254.2-4140s1c1
Sequence:CCGGCCCATGAGAACAGACCAAGATCTCGAGATCTTGGTCTGTTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-763s1c1
Sequence:CCGGGAGGGAAACACAGCAGTCATTCTCGAGAATGACTGCTGTGTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-1278s1c1
Sequence:CCGGCCTCTACAATGTCCAGGTGTTCTCGAGAACACCTGGACATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-3042s1c1
Sequence:CCGGCCCGTATACTATGGTGCCATTCTCGAGAATGGCACCATAGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-2697s1c1
Sequence:CCGGCGACATTAAGATGCAGTGCTTCTCGAGAAGCACTGCATCTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033254
VALIDATED
BOC MISSION shRNA Lentiviral Transduction Particles
BOC cell adhesion associated, oncogene regulated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-734s21c1
Sequence:CCGGTAGATGTGCAGCACGTGATTGCTCGAGCAATCACGTGCTGCACATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_033254.2-1786s21c1
Sequence:CCGGACCTCCAAGACAGACTCATATCTCGAGATATGAGTCTGTCTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033254.2-3695s21c1
Sequence:CCGGATATCCCAGAAAGACTATATACTCGAGTATATAGTCTTTCTGGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-2686s21c1
Sequence:CCGGGAGACCTCCTACGACATTAAGCTCGAGCTTAATGTCGTAGGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033254.2-3664s21c1
Sequence:CCGGACACCACCTCTCACAATTTAGCTCGAGCTAAATTGTGAGAGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033254.2-4140s1c1
Sequence:CCGGCCCATGAGAACAGACCAAGATCTCGAGATCTTGGTCTGTTCTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-763s1c1
Sequence:CCGGGAGGGAAACACAGCAGTCATTCTCGAGAATGACTGCTGTGTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-1278s1c1
Sequence:CCGGCCTCTACAATGTCCAGGTGTTCTCGAGAACACCTGGACATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-3042s1c1
Sequence:CCGGCCCGTATACTATGGTGCCATTCTCGAGAATGGCACCATAGTATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033254.2-2697s1c1
Sequence:CCGGCGACATTAAGATGCAGTGCTTCTCGAGAAGCACTGCATCTTAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks