EMAIL THIS PAGE TO A FRIEND

BOD1

biorientation of chromosomes in cell division 1

95 Gene Product Result for
Synonyms: FAM44B
UniProtKB ID: Q96IK1, B4DXH8, Q9BTW1
Gene ID:
Mouse(69556) biorientation of chromosomes in cell division 1
Rat(287173) biorientation of chromosomes in cell division 1
Zebrafish(767743) biorientation of chromosomes in cell division 1
chicken(416210) biorientation of chromosomes in cell division 1
domestic cat(101092914) biorientation of chromosomes in cell division 1
cow(540063) biorientation of chromosomes in cell division 1
dog(612987) biorientation of chromosomes in cell division 1
sheep(101107045) biorientation of chromosomes in cell division 1
domestic guinea pig(100727784) biorientation of chromosomes in cell division 1
naked mole-rat(101723040) biorientation of chromosomes in cell division 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024919 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024919 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024919 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138369 Rosetta Predictions human pricing
NM_001013854 Rosetta Predictions rat pricing
NM_001024919 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145833 predicted 1198
2 SASI_Hs01_00145835 predicted 516
3 SASI_Hs01_00145836 predicted 1181
4 SASI_Hs01_00145837 predicted 926
5 SASI_Hs01_00145838 predicted 655
6 SASI_Hs01_00145839 predicted 873
7 SASI_Hs01_00145834 predicted 1239
8 SASI_Hs01_00145840 predicted 1099
9 SASI_Hs01_00145841 predicted 838
10 SASI_Hs01_00145842 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061343 predicted 891
2 SASI_Rn02_00201118 predicted 488
3 SASI_Rn01_00061345 predicted 931
4 SASI_Rn01_00061346 predicted 990
5 SASI_Rn01_00061347 predicted 908
6 SASI_Rn01_00061348 predicted 936
7 SASI_Rn01_00061349 predicted 896
8 SASI_Rn01_00061350 predicted 1013
9 SASI_Rn01_00061351 predicted 948
10 SASI_Rn01_00061352 predicted 1036
11 SASI_Rn01_00061344 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024919 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139257 predicted 908
2 SASI_Mm01_00139259 predicted 402
3 SASI_Mm01_00139260 predicted 675
4 SASI_Mm01_00139261 predicted 902
5 SASI_Mm01_00139262 predicted 815
6 SASI_Mm01_00139263 predicted 567
7 SASI_Mm01_00139264 predicted 819
8 SASI_Mm01_00139265 predicted 803
9 SASI_Mm02_00287740 predicted 398
10 SASI_Mm02_00287741 predicted 900
11 SASI_Mm01_00139258 predicted 410
12 SASI_Mm01_00139266 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138369
VALIDATED
BOD1 MISSION shRNA Bacterial Glycerol Stock
biorientation of chromosomes in cell division 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1318s1c1
Sequence:CCGGCCAGTTTCCTTTCCTTTGTAACTCGAGTTACAAAGGAAAGGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1339s1c1
Sequence:CCGGCGAAACATGAAATCCTAGAATCTCGAGATTCTAGGATTTCATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138369.1-655s1c1
Sequence:CCGGGCCACAAATAGAACGAGCAATCTCGAGATTGCTCGTTCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-760s21c1
Sequence:CCGGTCAGGACACTTCCTAAGAATACTCGAGTATTCTTAGGAAGTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-470s21c1
Sequence:CCGGCTGAGGCAGAAAGTGGATAATCTCGAGATTATCCACTTTCTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-1190s21c1
Sequence:CCGGATTAGCTGGGAGTAGTCTTTGCTCGAGCAAAGACTACTCCCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-656s21c1
Sequence:CCGGCCACAAATAGAACGAGCAATTCTCGAGAATTGCTCGTTCTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-596s21c1
Sequence:CCGGGCTGGAGTAGACAGGATTATTCTCGAGAATAATCCTGTCTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138369
VALIDATED
BOD1 MISSION shRNA shRNA Plasmid DNA
biorientation of chromosomes in cell division 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1318s1c1
Sequence:CCGGCCAGTTTCCTTTCCTTTGTAACTCGAGTTACAAAGGAAAGGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1339s1c1
Sequence:CCGGCGAAACATGAAATCCTAGAATCTCGAGATTCTAGGATTTCATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138369.1-655s1c1
Sequence:CCGGGCCACAAATAGAACGAGCAATCTCGAGATTGCTCGTTCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-760s21c1
Sequence:CCGGTCAGGACACTTCCTAAGAATACTCGAGTATTCTTAGGAAGTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-470s21c1
Sequence:CCGGCTGAGGCAGAAAGTGGATAATCTCGAGATTATCCACTTTCTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-1190s21c1
Sequence:CCGGATTAGCTGGGAGTAGTCTTTGCTCGAGCAAAGACTACTCCCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-656s21c1
Sequence:CCGGCCACAAATAGAACGAGCAATTCTCGAGAATTGCTCGTTCTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-596s21c1
Sequence:CCGGGCTGGAGTAGACAGGATTATTCTCGAGAATAATCCTGTCTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138369
VALIDATED
BOD1 MISSION shRNA Lentiviral Transduction Particles
biorientation of chromosomes in cell division 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1318s1c1
Sequence:CCGGCCAGTTTCCTTTCCTTTGTAACTCGAGTTACAAAGGAAAGGAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138369.1-1339s1c1
Sequence:CCGGCGAAACATGAAATCCTAGAATCTCGAGATTCTAGGATTTCATGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138369.1-655s1c1
Sequence:CCGGGCCACAAATAGAACGAGCAATCTCGAGATTGCTCGTTCTATTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-760s21c1
Sequence:CCGGTCAGGACACTTCCTAAGAATACTCGAGTATTCTTAGGAAGTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-470s21c1
Sequence:CCGGCTGAGGCAGAAAGTGGATAATCTCGAGATTATCCACTTTCTGCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-1190s21c1
Sequence:CCGGATTAGCTGGGAGTAGTCTTTGCTCGAGCAAAGACTACTCCCAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-656s21c1
Sequence:CCGGCCACAAATAGAACGAGCAATTCTCGAGAATTGCTCGTTCTATTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138369.1-596s21c1
Sequence:CCGGGCTGGAGTAGACAGGATTATTCTCGAGAATAATCCTGTCTACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024919
VALIDATED
BOD1 MISSION shRNA Bacterial Glycerol Stock
biorientation of chromosomes in cell division 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-401s1c1
Sequence:CCGGCGTGTCAACACATCTGGACAACTCGAGTTGTCCAGATGTGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024919.1-855s1c1
Sequence:CCGGGCTCATGGATTGTGTTACCTTCTCGAGAAGGTAACACAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-541s1c1
Sequence:CCGGCCAAACTAAACCACATCTTCACTCGAGTGAAGATGTGGTTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-669s21c1
Sequence:CCGGCAGGATGCTTCCTAAGAATTTCTCGAGAAATTCTTAGGAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024919.1-479s21c1
Sequence:CCGGCGTGGTTCAGTCAGGTATGTTCTCGAGAACATACCTGACTGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-725s21c1
Sequence:CCGGGACTCCTGCTTCATACGAATACTCGAGTATTCGTATGAAGCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-403s21c1
Sequence:CCGGTGTCAACACATCTGGACAAACCTCGAGGTTTGTCCAGATGTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-379s21c1
Sequence:CCGGTAAGGCAGAAGGTGGATAATTCTCGAGAATTATCCACCTTCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024919
VALIDATED
BOD1 MISSION shRNA shRNA Plasmid DNA
biorientation of chromosomes in cell division 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-401s1c1
Sequence:CCGGCGTGTCAACACATCTGGACAACTCGAGTTGTCCAGATGTGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024919.1-855s1c1
Sequence:CCGGGCTCATGGATTGTGTTACCTTCTCGAGAAGGTAACACAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-541s1c1
Sequence:CCGGCCAAACTAAACCACATCTTCACTCGAGTGAAGATGTGGTTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-669s21c1
Sequence:CCGGCAGGATGCTTCCTAAGAATTTCTCGAGAAATTCTTAGGAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024919.1-479s21c1
Sequence:CCGGCGTGGTTCAGTCAGGTATGTTCTCGAGAACATACCTGACTGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-725s21c1
Sequence:CCGGGACTCCTGCTTCATACGAATACTCGAGTATTCGTATGAAGCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-403s21c1
Sequence:CCGGTGTCAACACATCTGGACAAACCTCGAGGTTTGTCCAGATGTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-379s21c1
Sequence:CCGGTAAGGCAGAAGGTGGATAATTCTCGAGAATTATCCACCTTCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024919
VALIDATED
BOD1 MISSION shRNA Lentiviral Transduction Particles
biorientation of chromosomes in cell division 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183870    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-401s1c1
Sequence:CCGGCGTGTCAACACATCTGGACAACTCGAGTTGTCCAGATGTGTTGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180778    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024919.1-855s1c1
Sequence:CCGGGCTCATGGATTGTGTTACCTTCTCGAGAAGGTAACACAATCCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024919.1-541s1c1
Sequence:CCGGCCAAACTAAACCACATCTTCACTCGAGTGAAGATGTGGTTTAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-669s21c1
Sequence:CCGGCAGGATGCTTCCTAAGAATTTCTCGAGAAATTCTTAGGAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024919.1-479s21c1
Sequence:CCGGCGTGGTTCAGTCAGGTATGTTCTCGAGAACATACCTGACTGAACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-725s21c1
Sequence:CCGGGACTCCTGCTTCATACGAATACTCGAGTATTCGTATGAAGCAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-403s21c1
Sequence:CCGGTGTCAACACATCTGGACAAACCTCGAGGTTTGTCCAGATGTGTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001024919.1-379s21c1
Sequence:CCGGTAAGGCAGAAGGTGGATAATTCTCGAGAATTATCCACCTTCTGCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks