EMAIL THIS PAGE TO A FRIEND

BOD1L1

biorientation of chromosomes in cell division 1-like 1

91 Gene Product Result for
Synonyms: BOD1L FAM44A
UniProtKB ID: Q8NFC6, Q6P0M8, Q96AL1, Q9H6G0, Q9NTD6, Q9P2L9
Gene ID:
Rat(207118) biorientation of chromosomes in cell division 1-like 1
domestic cat(101092265) biorientation of chromosomes in cell division 1-like 1
naked mole-rat(101725647) biorientation of chromosomes in cell division 1-like 1
domestic guinea pig(100730155) biorientation of chromosomes in cell division 1-like 1
sheep(101115795) biorientation of chromosomes in cell division 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052251 MISSION® esiRNA esiRNA human FAM44A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148894 Rosetta Predictions human pricing
XM_001060944 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016906 predicted 706
2 SASI_Hs01_00016907 predicted 2752
3 SASI_Hs02_00365606 predicted 8756
4 SASI_Hs02_00365607 predicted 4228
5 SASI_Hs01_00016908 predicted 5629
6 SASI_Hs01_00016909 predicted 5201
7 SASI_Hs02_00365608 predicted 9029
8 SASI_Hs01_00016911 predicted 7878
9 SASI_Hs01_00016912 predicted 6599
10 SASI_Hs01_00016913 predicted 2561
11 SASI_Hs01_00016910 predicted 742
12 SASI_Hs01_00016914 predicted 2817
13 SASI_Hs01_00016915 predicted 8890
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298207 predicted 517
2 SASI_Rn02_00298208 predicted 2058
3 SASI_Rn02_00298209 predicted 6691
4 SASI_Rn02_00298210 predicted 7160
5 SASI_Rn02_00298211 predicted 7936
6 SASI_Rn02_00298212 predicted 574
7 SASI_Rn02_00298213 predicted 6308
8 SASI_Rn02_00298214 predicted 6009
9 SASI_Rn02_00298215 predicted 4175
10 SASI_Rn02_00298216 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148894
BOD1L1 MISSION shRNA Bacterial Glycerol Stock
biorientation of chromosomes in cell division 1-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-6263s21c1
Sequence:CCGGCTACAGCCAGTGGTGATATTACTCGAGTAATATCACCACTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-8679s21c1
Sequence:CCGGGAACGATGATGACACCATAAACTCGAGTTTATGGTGTCATCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148894.2-9858s21c1
Sequence:CCGGACTCGCATGTATCCAAGTAAACTCGAGTTTACTTGGATACATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-3526s21c1
Sequence:CCGGACCCAAGACAACCGCAATAATCTCGAGATTATTGCGGTTGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-1570s1c1
Sequence:CCGGGATGATGAGCTTACTGTAGAACTCGAGTTCTACAGTAAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-694s1c1
Sequence:CCGGCCCAGTGCTAATGTAGCCAATCTCGAGATTGGCTACATTAGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-709s1c1
Sequence:CCGGGCCAATGATGCCATGTCGATACTCGAGTATCGACATGGCATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148894
BOD1L1 MISSION shRNA shRNA Plasmid DNA
biorientation of chromosomes in cell division 1-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-6263s21c1
Sequence:CCGGCTACAGCCAGTGGTGATATTACTCGAGTAATATCACCACTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-8679s21c1
Sequence:CCGGGAACGATGATGACACCATAAACTCGAGTTTATGGTGTCATCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148894.2-9858s21c1
Sequence:CCGGACTCGCATGTATCCAAGTAAACTCGAGTTTACTTGGATACATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-3526s21c1
Sequence:CCGGACCCAAGACAACCGCAATAATCTCGAGATTATTGCGGTTGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-1570s1c1
Sequence:CCGGGATGATGAGCTTACTGTAGAACTCGAGTTCTACAGTAAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-694s1c1
Sequence:CCGGCCCAGTGCTAATGTAGCCAATCTCGAGATTGGCTACATTAGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-709s1c1
Sequence:CCGGGCCAATGATGCCATGTCGATACTCGAGTATCGACATGGCATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148894
BOD1L1 MISSION shRNA Lentiviral Transduction Particles
biorientation of chromosomes in cell division 1-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-6263s21c1
Sequence:CCGGCTACAGCCAGTGGTGATATTACTCGAGTAATATCACCACTGGCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-8679s21c1
Sequence:CCGGGAACGATGATGACACCATAAACTCGAGTTTATGGTGTCATCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148894.2-9858s21c1
Sequence:CCGGACTCGCATGTATCCAAGTAAACTCGAGTTTACTTGGATACATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148894.2-3526s21c1
Sequence:CCGGACCCAAGACAACCGCAATAATCTCGAGATTATTGCGGTTGTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-1570s1c1
Sequence:CCGGGATGATGAGCTTACTGTAGAACTCGAGTTCTACAGTAAGCTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-694s1c1
Sequence:CCGGCCCAGTGCTAATGTAGCCAATCTCGAGATTGGCTACATTAGCACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_148894.1-709s1c1
Sequence:CCGGGCCAATGATGCCATGTCGATACTCGAGTATCGACATGGCATCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks